Содержание

Фундаментные блоки: маркировка по ГОСТ, размеры

Маркировка фундаментных блоков несет в себе информацию для покупателя о размерах изделия и материала, из которого оно изготавливалось.

Различают 3 основных типа фундаментных блоков:

  • ФБС – блоки фундаментные сплошные.
  • ФБВ – блоки с продольным вырезом, предусмотренным для прокладки коммуникаций.
  • ФБП – блоки с полостью прямоугольной формы.

Габариты изделий – длину, ширину и высоту – принято указывать в дециметрах, округляя до них значения в метрах. Типовые размеры блоков позволяют подобрать изделия нужных габаритов для любого фундамента, без дополнительной подгонки.

По ГОСТУ выделяют три вида типовых размеров блоков ФБС:

  • Блоки ФБС 2,38 м в длину. При этом высота составляет 0,58 м, а ширина – от 300 до 600 м.
  • Блоки 1,18 м в длину. Выпускаются с высотами 0,58 и 0,28 м, шириной значением 400 мм, 500 и 600 мм.
  • Блоки 0,88 м в длину. Высота составляет 0,58 м и выпускаются со значениями 300, 400, 500 и 600 мм по ширине.

При обозначении размера блока последовательно указываются: длина, ширина, высота. Например, блок 1,18 м в длину с шириной полметра и высотой 0,58 м будет иметь такое обозначение: 12-5-5.

Большинство блоков производят из бетона М-100 с известковым щебнем. Этот тип бетона имеет большую прочность на сжатие – самый важный параметр, учитывая область применения изделий. Чтобы обозначить материал, из которого сделан фундаментный блок, применяется буквенная маркировка. Так, буква «Т» обозначает тяжелый бетон, «С» - силикатный, «П» - пористый, «Л» - легкий бетон.

Таким образом, ФБС 12-3-6т расшифровывается: фундаментный блок сплошной, с длиной 1,18 м, 0,3 м по ширине и 0,6 м в высоту, изготовленный из тяжелого бетона.

По ГОСТу, допустимы следующие отклонения в заявленных размерах фундаментных блоков:

  • до 13 мм по длине;
  • до 3 мм по линейности;
  • до 8 мм по высоте и ширине.

Расчет количества блоков для закладки основания постройки довольно прост: объем будущего фундамента следует разделить на объем типового блока, который планируется использовать. При этом блоки выдерживают такую огромную нагрузку, что могут служить основой для возведения здания до 12 этажей.

При монтаже блоков главное, что нужно учитывать – отсутствие монолитности подобного фундамента. Поэтому перед установкой ФБС заливается армированный бетонный пояс в случае, если сами блоки не оснащены арматурой. Идеальный грунт для фундаментных блоков – крупный песочный при водоносном горизонте на глубине.

Звоните +7 (863) 296-39-51 и наши менеджеры ответят на все Ваши вопросы.

Размеры фундаментных блоков фбс: технические характеристики и маркировка

 

Устройство надежного фундамента – необходимое условие при строительстве прочного и долговечного дома. В современном строительстве все более популярны сборные или комбинированные фундаментные конструкции. Оптимизировать затраты на сооружение фундамента с обеспечением его высокой прочности позволяют бетонные фундаментные блоки Ф, ФЛ, ФБС и другие, широкий ассортимент которых позволяет подобрать продукцию подходящих размеров.

Технические характеристики

По форме эта продукция представляет собой прямоугольный параллелепипед, материалы для изготовления: тяжелый, керамзитовый или силикатный бетон, плотность которого не менее 1800 кг/м3.

Класс прочности на сжатие и размеры этой продукции определяют:

  • прочность создаваемой конструкции;
  • технология укладки;
  • сроки проведения работ;
  • стоимость продукции.

Размеры фундаментных блоков регламентируются ГОСТом 13579-89, их выбор зависит от:

  • толщины стен;
  • характеристик грунта;
  • массы строения;
  • требуемой прочности основания;
  • площади фундамента.

Маркировка фундаментных блоков: Ф, ФЛ, ФБС, БФ, ФР, ФБП

Тип элементов нулевого цикла обозначается буквенно-цифровыми символами. Буквы означают:

  • Ф – изделия стаканного типа, устанавливаются под колонны, изготавливаются из тяжелого бетона или железобетона;
  • ФЛ – ж/б продукция, применяемая для устройства ленточных фундаментов;
  • ФБС – сплошные неармированные изделия, востребованные для сооружения фундаментов, стен подвалов и технических подполий;
  • ФБП – блоки фундаментные пустотные;
  • БФ – ж/б ленточные, используются при возведении стен объектов сельскохозяйственного и промышленного назначения;
  • ФР – ж/б элементы для трехшарнирных рам.

В маркировке после букв располагаются цифры, которые характеризуют размеры изделий, выраженные в дециметрах, округленных до целых чисел:

  • для ФЛ указывают ширину и длину блока;
  • для остальных – длину, ширину, высоту.

Как правильно выбрать элементы для нулевого цикла?

Советы по выбору размеров фундаментного блока:

  • Оптимально, чтобы на длину стены приходилось 4-5 штук.
  • Чем неустойчивей грунт, тем габаритнее должны быть блоки. Для глин и суглинков, оказывающих давление на элементы нулевого цикла, выбирают крупногабаритные полнотелые изделия ФБС 24.6.6. Для использования на сухих песчаных грунтах, не требующих глубокой закладки фундаментной ленты, подойдут ФБС 12.6.6.
  • Блок может выступать с одной стороны стены не более чем на 100 мм, с обеих сторон – не более чем по 60 мм.

Таблица размеров и других характеристик фундаментных блоков ФБС

Цифровое обозначение

Размеры, мм

Масса, кг

Длина

Ширина

Высота

24.3.6

2380

300

580

970

24.4.6

2380

400

580

1300

24.5.6

2380

500

580

1630

24.6.6

2380

600

580

1960

12.2.6

1180

200

580

320

12.3.6

1180

300

580

485

12.4.6

1180

400

580

640

12.5.6

1180

500

580

790

12.6.6

1180

600

580

960

12.2.3

1180

200

280

160

12.3.3

1180

300

280

240

12.4.3

1180

400

280

310

12.5.3

1180

500

280

380

12.6.3

1180

600

280

460

9.2.6

880

200

580

235

9.3.6

880

300

580

350

9.4.6

880

400

580

470

9.5.6

880

500

580

590

9.6.6

880

600

580

700

Для малоэтажных домов небольшой массы, построенных из дерева или пеноблоков, производители предлагают малогабаритные изделия, выпускаемые в соответствии с ТУ с размерами 400х200х200 мм. Их можно укладывать самостоятельно, без использования тяжелой строительной техники. Также популярны нестандартные ФБС 6.6.6 из тяжелых бетонов, применяемые для сооружения:

  • стен подвалов;
  • фундаментов столбчатого типа для небольших строений сезонного проживания;
  • для создания комбинированных оснований – в сочетании с ленточными фундаментами.
Поделиться ссылкой:

Производим и предлагаем продукцию:

Читайте также:

Блоки ФБС размеры | Фундамент для Дома

Фундаментные блоки стеновые являются наиболее востребованными в сфере современного строительства, ведь они доказали свою эффективность и надежность на практике. Поэтому, большинство профессионалов выбирают именно этот материал при возведении какой-либо постройки.

При этом специалисты стараются учитывать не только морозостойкость, вес, плотность материала, но и габариты блоков ФБС, которые прописываются в соответствующем государственном стандарте.

ГОСТ, определяющий размеры стеновых фундаментных блоков

Основным государственным стандартом, который регулирует размеры фундаментных блоков ФБС, является ГОСТ 13579-78. Он распространяет свое действие на материалы, изготавливаемые из плотного, легкого и силикатного бетона, с плотностью не менее  1800 кг/м

3 и которые предназначаются для технических подвалов зданий и стен подвалов.

Согласно ему различают несколько типов блоков, от которых и зависит параметры материала (длина, высота, ширина).

В этом документе также представлены блоки ФБС размеры, которых имеют свои условные обозначения. А в зависимости от того, из какого типа бетона изготовлена железобетонная конструкция, блоку присваивается определенная маркировка. Она определяется также исходя из класса бетона по прочности, массы блока, расхода материалов и марки монтажной петли.

Но размеры фундаментных блоков ФБС – это еще не весь перечень того, что регулирует данный стандарт. Правила хранения, транспортировки блоков и присвоения маркировки также указываются в этом документе.

Размеры стеновых фундаментных блоков

Сортамент данного типа блоков состоит из 14 типоразмеров изделий.

При этом основной размерной характеристикой для таких железобетонных конструкций является их ширина, а второстепенными размерами блоков ФБС принято считать длину и высоту.

Согласно длине весь сортамент материалов подразделяется на 3 типоразмера:

  • 2300 мм;
  • 1180 мм;
  • 880 мм.

Размеры фундаментных блоков по ГОСТу также учитывают высоту изделий. Согласно этому параметру сортамент делится на 2 группы:

Блоки ФБС, размеры которых также включают ширину, подразделяются на изделия с параметрами:

Таким образом, выходит, что самый большой блок достигает параметров 2380х600х580 мм (длина, высота, ширина), а фундаментные блоки размеры, которых по ГОСТ самые маленькие укладываются в габариты 880х300х580 мм.

Как правильно подобрать размеры ФБС

Для того чтобы правильно определиться с параметрами фундаментных блоков, необходимо изначально грамотно рассчитать площадь основания, выяснить, какой будет кладка и учесть толщину перекрытий и возводимых стен. Фундаментные блоки, размеры которых вы уже определили для себя, имеют еще и особенную маркировку.

Она представляет собой защитный код, в котором содержится информация для покупателя. К примеру, ФБС 6-4-6 говорит о том, что железобетонная конструкция имеет высоту 600 мм, ее длина составляет 400 мм, а ширина – 600 мм.

Если размеры блоков ФБС указываются в маркировке в таком виде ФБС 24-6-6 т., это значит, что блок имеет длину 2400 мм, высоту и ширину – по 600 мм.

При этом буква «т» указывает на то, что конструкция изготовлена из тяжелого бетона.

Размеры фундаментных блоков также важно учитывать, исходя из характера грунта. Например, для глинистых и вздувающихся грунтов рекомендуется выбирать блоки типа ФБС 24-6-6 либо подобные им. На выбор параметров блоков также влияют:

  • Деформация почвы;
  • Нагрузка стен, трасс, колон;
  • Глубина их укладки.

Учитывая все факторы, можно построить хорошо отапливаемое подвальное помещение, что не всегда возможно сделать с другими типами фундамента. Выбрав блоки ФБС, размеры которых абсолютно соответствуют будущей постройке, а также, учитывая характеристики самого материала: его плотность, морозоустойчивость, долговечность, можно добиться возведения идеального здания, которое будет отличаться от других своей прочностью и безупречным внешним видом.

Размеры бетонных блоков ФБС прямым образом влияют и на вес конструкций. Этот фактор необходимо учитывать, ведь для транспортировки и укладки блоков обязательно понадобится грузоподъемный транспорт и техника.

На нашем сайте вы можете посмотреть возможные размеры фундаментных блоков, оценить внешний вид таких конструкций и решить для себя, какие параметры вам понадобятся. Ведь, прежде всего, необходимо предварительно продумать ход работ, определиться с типом изделий, учесть все нюансы строительства, а уже после этого выбирать конструкции исходя из их габаритов.

характеристики и размеры, расшифровка маркировки, цены

Фундамент принимает на себя нагрузку от стен, крыши, перекрытий и равномерно распределяет ее на землю. Выбор искусственного основания зависит от гидрологических и геологических условий, а также типа и массивности строения. Для участков с твердым грунтом и незначительной влажностью рекомендуется использовать фундаментные блоки строительные (ФБС). Что собой представляет такой базис, какие бывают размеры, вес и как дорого можно его приобрести? Чтобы ответить на все вопросы, подробно изучим особенности.

Оглавление:

  1. Технические параметры
  2. Маркировка и типовые размеры
  3. Плюсы и минусы
  4. Сфера применения и цены

Характеристики

Согласно ГОСТ 13579-78 в производстве используются тяжелые, керамзитные или плотные силикатные бетоны. Это сырье конструкционного типа, из которого получают литые изделия повышенной крепости и плотности. К соблюдению стандартных размеров и веса фундаментных блоков предъявляются самые строгие требования. От этого зависит прочность основания и долговечность всего строения.

Так как элементы испытывают нагрузку на сжатие, в них присутствует внутренняя арматура, предусмотрена закладка монтажных петель из гладкого горячекатаного прутка. Это необходимо для удобства перемещения и транспортировки плит ФБС.

Для придания строительному материалу соответствующей твердости применяют две технологии:

  • Просушка – схватывание бетона происходит естественным образом. Блоки располагают в крытом проветриваемом помещении и выдерживают в течение нескольких недель.
  • Пропарка – ускоренный способ обработки под воздействием высокого давления в условиях повышенной влажности. Достичь нормативной твердости в 70 % удается всего за сутки.

Качество изделий, полученных разными способами, совершенно одинаковое. Но из-за дорогой технологии цена пропаренных немного выше.

Условные обозначения

Аббревиатура ФБС дословно расшифровывается как фундаментные блоки строительные или сплошные. Под названием подразумевается цельная отливка с гладкими поверхностями. По форме она напоминает кирпич, только гораздо большего размера. В торцах имеются неглубокие вырезы, которые заполняют бетоном, соединяя элементы между собой во время монтажа.

Кроме типовых форм существуют другие виды, отличающиеся конфигурацией.

1. ФБВ – с отверстиями для прокладки инженерных коммуникаций и укладки перемычек.

2. ФБП – модули с пустотными камерами, открытыми вниз.

В нормативной документации предусмотрены такие типовые размеры блоков ФБС:

  • длина 600/900/1200/2400 мм;
  • ширина 300/400/500/600 мм;
  • высота 300/600 мм.

Вес изделий разных габаритов может колебаться от 0,25 до 2 тонн.

Маркировка включает в себя тип, размеры в дециметрах и вид бетона. Например, расшифровка ФБС12.3.6–Т выглядит так:

  • ФБС – фундаментные блоки сплошные;
  • 12 – длина 1180 мм;
  • 3 – ширина 300 мм;
  • 6 – высота 580 мм;
  • Т – тяжелый бетон.

Зная основные размеры, определяют, сколько всего штук нужно купить для строительства. Ориентируясь на вес, рассчитывают число модулей для перевозки в одной машине. Если в этих выкладках учесть актуальную стоимость, то нетрудно запланировать предварительную сумму расходов.

Преимущества и недостатки

Намечая строительство на основе ФБС, следует хорошо взвесить их сильные и слабые стороны. Это поможет утвердиться в целесообразности выбора основного материала.

Достоинства:

1. Высокая прочность. Бетонные блоки способны равномерно распределять и выдерживать значительные нагрузки.

2. Универсальность применения. Материал активно востребован в гражданском и промышленном строительстве.

3. Устойчивость к погодным условиям Независимость от времени года и атмосферных явлений позволяет проводить работы круглый год в любой климатической зоне.

4. Стандартные размеры. Типовые габариты позволяют делать точные расчеты стройматериала при закупке.

5. Сжатые сроки монтажа. При заказе готовой конструкции отпадает необходимость в трудоемком и длительном процессе изготовления монолитной плиты. Ускоренные темпы строительства снижают общую стоимость блочного объекта на 20-25%.

6. Простота укладки. Благодаря стальным петлям, закрепленным в бетоне, упрощается разгрузка краном и монтаж.

7. Конструктивность. Наличие пазов усиливает соединительные швы.

8. Долговечность. Расчетный срок службы построек из блоков составляет 40-50 лет.

Недостатки:

  • Необходимость привлечения бригады профессиональных строителей и специальной техники.
  • Большой риск проседания отдельных участков фундамента.

Где применяются ФБС?

Сплошные бетонные изделия предназначены для закладки фундаментов многоэтажных или массивных строений. Основания из блоков и монолитных плит находятся на одном качественном уровне. Однако использование первых значительно снижает стоимость и ускоряет строительство. Они активно применяются при сооружении цокольных этажей, погребов, подвальных, технических помещений, неотапливаемых объектов. Для кладки стен подходят пустотные модули ФБП, вес которых намного меньше.

Блоки, уже побывавшие в употреблении, продаются по стоимости, сниженной на 30-50 %. Поэтому их нередко применяют в качестве стационарного или временного ограждения различных объектов.

Маркировка изделийМасса, кгЦена, руб/шт
6-3-6240-250690-850
6-4-6300-310860-960
6-5-6350-3901010-1020
9-3-6350-370580-990
9-4-3220-240690-820
9-4-6470-490780-1230
9-5-3280-300750-970
9-5-6590-610980-1550
9-6-6700-7401230-1850
12-3-3240-270450-630
12-3-6460-510770-1280
12-4-3310-330530-1100
12-4-6640-6751060-1670
12-5-3360-380670-1360
12-5-6790-8001300-2070
12-6-3460-480810-1490
12-6-6940-9601580-2500
24-3-6970-10251520-2350
24-4-61300-13502000-3000
24-5-3790-12001700-2200
24-5-51560-15902690-3200
24-5-61630-16802500-3650
24-6-31000-10202040-3100
24-6-61960-19803000-3970

ФБС 9.3.6 блок фундаментный - размеры, вес, цена Москва

Фундаментные блоки ФБС 9.3.6 представляют собой высококачественные железобетонные изделия, использующиеся для возведения фундаментов жилых, промышленных или хозяйственных объектов, подвалов, цокольных участков. Блок ФБС 9.3.6 производится по ГОСТ 13579-78 - серия 1.116.1-8. Наличие таких блоков гарантирует оперативное возведение и долгосрочную устойчивость сооружения.

ФБС 9.3.6 являются устойчивыми к низким температурам, обладают повышенной прочностью, а их характеристики отвечают требованиям современных государственных стандартов качества. Блоки способны выдерживать серьезные нагрузки и не чувствительны к резким переменам погоды и катаклизмам.

Особенности

Блок ФБС 9.3.6 обладает формой параллелепипеда, но в отдельных случаях форма может варьироваться в зависимости от конфигурации сооружения и персональных пожеланий. Поверхность как правило, гладкая, но возможны отклонения от данной закономерности при обработке гидроизоляционными смесями, являющимися гарантом водонепроницаемости бетона.

Сплошные фундаментные блоки (а именно так расшифровывается аббревиатура) используются:

- для возведения стен несущего характера;
- для строительства фундаментных оснований;
- для возведения подпорных стенок, мостов, пандусов, эстакад;
- для строительства объектов инженерного типа;
- в строительстве объектов хозяйственного и жилого направления в целом;
- для возведения ограждений и заборов.

Явным достоинством ФБС 9.3.6 является тот факт, что при использовании блоков не нужно производить технологических перерывов для приобретения материалом прочности. Фундаментные блоки разрешено применять в строительстве в любой сезон независимо от температурного режима. Этот факт помогает ощутимо сократить время, которое задействуется на возведение объекта.

К преимуществам фундаментных блоков относится следующее:

- позволяют возводить объекты независимо от погодных условий и сезона;
- на строительство тратится намного меньше времени;
- отличаются удобством монтажа;
- блоки способны выдерживать большие нагрузки и перемены температуры.

Почему выгодно приобретать фундаментные блоки именно у нашего завода:

- мы предлагаем сертифицированную и высококачественную продукцию, соответствующую последним требованиям и стандартам;
- клиент может выбрать искомый товар среди широкого спектра изделий любого размера и требуемых характеристик;
- наш завод гарантирует быструю доставку заказа;
- гуманные цены;

Маркировка ФБС 9.3.6 габариты 880х300х580

Железобетонные изделия  этой серии выпускаются в различных размерных и конструктивных вариациях, поэтому в производстве встречаются ЖБИ с различной буквенно-цифровой маркировкой.

Цифры обозначают размер (толщину изделия).

Маркировка римскими цифрами показывает тип арматуры (напрягаемая стержневая, ненапрягаемая).

Доставка ФБС 9.3.6

Доставка ФБС 9.3.6 осуществляется собственным транспортом в г. Москва, области и другим регионам России! Расчет доставки можно заказать в разделе Доставка.

Транспортировать тяжеловесный груз согласно ГОСТ 13579-78 разрешено только в горизонтальном положении в спецтранспорте. При погрузке/разгрузке запрещено перемещать по нескольку штук. Исключение: такелажные работы специальными устройствами, где допускается подъем одновременно нескольких изделий.

Блок ФБС 9.3.6 цена в Москве

Блоки ФБС 9.3.6 цена за штуку и зависит от их размера, толщины, наличия/отсутствия укрепляющих добавок, армирования. Чтобы не переплачивать за товар, целесообразно заказать напрямую от производителя на заводе ПСК Перспектива. Так вы получите сертифицированные железобетонные изделия с лабораторным заключением и по оптимальной стоимости.

Наша компания может предложить вам оптимальный баланс между качеством и стоимостью.

Наш прайс можно запросить оформить заказ в интересующем Вас разделе сайта.

Купить блок ФБС 9.3.6 на заводе ЖБИ

Выгодно купить блоки ФБС 9.3.6 в Москве без посредников на заводе ЖБИ Перспектива. Новые ФБС 9.3.6 всегда есть в наличии на наших складах. Сейчас мы наращиваем производственную мощность и ищем новых надежных партнеров. 

Аналоги написания ЖБИ на заводе жбк и дск ФБС 9.3.6, ФБС9.3.6

Бетонные блоки ФБС размеры, вес и маркировка.

Бетонные блоки для стен подвалов. Виды.

      Блоки стен подвалов подразделяются на три вида: ФБС - сплошные; ФБВ - сплошные с вырезом для укладки перемычек и пропуска коммуникаций под потолками подвалов и технических подпольев; ФБП - пустотные (с открытыми вниз пустотами).        Ниже подробнее описаны блоки сплошные ФБС из тяжелого бетона. Если Вас интересуют ФБС из бетона на пористых заполнителях (керамзитобетон) или из плотного силикатного бетона, а также блоки ФБВ или ФБП подробную информацию читайте в ГОСТ 13579-78* "Блоки бетонные для стен подвалов. Технические условия".

Блоки для стен подвалов сплошные (ФБС)

       Самое широкое применение в строительстве получили бетонные блоки ФБС из тяжелого бетона (индекс Т в конце маркировки). В основном из них выполняют сборные ленточные фундаменты, стены подвалов зданий, подпорные стены удерживающие грунт. Кроме монтажных петель арматура в блоках ФБС отсутствует.

Плюсы блоков ФБС:

1. Высокая прочность.
2. Высокая скорость монтажа стен.
3. Долговечность, (как вариант возможно использовать б/у блоки).
4. Широкое распространение.
5. Большой вес (при выполнении из блоков подпорных стен).

Минусы блоков ФБС:

1. Высокая стоимость.
2. Большой вес - для разгрузки и монтажа необходим кран.
3. Высокая теплопроводность от 0.9 до 1.75 Вт/(м•град).

Маркировка

Размеры и вес блоков ФБС

       Блоки имеют стандартные размеры указанные в ГОСТ 13579-78. Ширина в зависимости от необходимой толщины стены бывает 300, 400, 500, 600 мм. Высота кратно 600 мм (580 мм блок плюс 20 мм толщина раствора) и кратно 300 мм (280 мм блок плюс 20 мм раствор). Длина 2380 мм, 1180 мм и 880 мм, вертикальный шов выполняется из раствора также толщиной 20 мм.
№ п/п Эскиз блока Марка изделия Размеры в мм Масса, т
Длина L Ширина b Высота h
1 ФБС24.3.6-Т 2380 300 580 0,97
2 ФБС24.4.6-Т 2380 400 580 1,30
3 ФБС24.5.6-Т 2380 500 580 1,63
4 ФБС24.6.6-Т 2380 600 580 1,96
5 ФБС12.4.6-Т 1180 400 580 0,64
6 ФБС12.5.6-Т 1180 500 580 0,79
7 ФБС12.6.6-Т 1180 600 580 0,96
8 ФБС12.4.3-Т 1180 400 280 0,31
9 ФБС12.5.3-Т 1180 500 280 0,38
10 ФБС12.6.3-Т 1180 600 280 0,46
11 ФБС9.3.6-Т 880 300 580 0,35
12 ФБС9.4.6-Т 880 400 580 0,47
13 ФБС9.5.6-Т 880 500 580 0,59
14 ФБС9.6.6-Т 880 600 580 0,70

Что ещё почитать на сайте:

Фундамент из блоков ФБС пошаговая инструкция. Армирование ленточного фундамента, гидроизоляция.

Требования к ограждению строительной площадки. Примеры и фото ограждений.

Статья о том как проводить испытание свай динамической нагрузкой. Технология испытания грунтов динамической ударной нагрузкой забивными сваями.

Размеры по ГОСТу- Таблица +Видео монтажа

Фундаментные блоки строительные, или проще ФБС, в наше время самые распространенный вид железобетонных изделий. Готовые блоки проще и дешевле закладывать в фундамент дома, чем заливать сплошным бетоном и ждать пока он застынет. Блок ФБС используют для строительства цокольных стен и подвалов. 

[contents]

Виды ФБС блоков для фундамента

Задача  ФБС блоков выдерживать огромные нагрузки, удерживая на себе вес всего здания. Выбирая фундаментные блоки, следует учитывать их способности к пожаростойкости, водонепроницаемости и морозостойкости.

Согласно с ГОСТ 13579-78 фундаментные блоки подразделяются на три вида – ФБС, ФБВ и ФБП. Изготавливают их из силикатного, керамзитобетона или из тяжелого бетона.

ФБС – полнотелые изделия из бетона, самые прочные в сравнении с другими видами. Именно этот тип применяют для постройки фундамента дома, подвалов или технических подполий. Изготавливают в виде параллелепипеда, металл используется только для специальных петель, предназначенных для монтажа блоков.

Блоки вида ФБВ наименее распространенные и их следует заранее заказывать у производителя. От блоков ФБС отличаются наличием продольного выреза предусмотренного под коммуникации.

Марка ФБП – пустотный фундаментный блок. У них одна стандартная длина 2,4 м, но по высоте и ширине могут отличаться. Облегченные блоки изготавливаются оставляя вертикально-замкнутые или горизонтальные пустоты.

Блоки ФБП не рекомендуют применять при влажном, вязком грунте.

По технологии блоки ФБС уплотняют с помощью вибрации, стандартные опоки должны обеспечивать одинаковые размеры всех изделий и гладкую поверхность. Если технология нарушена, невозможно будет ровно уложить все блоки, появятся щели, скосы, что значительно уменьшит качества фундамента к гидро- и теплоизоляции.

Кроме ГОСТовских, различают ещё несколько маркировок. Для справки, приведём краткий список конструкций элементов нулевого цикла:

  • Ф – это железобетонная или бетонная конструкция для из утяжелённого бетона, предназначенная для колонн, как правило, стаканного типа;
  • ФЛ – так же, железобетон из тяжёлого бетона, предназначается под устройство ленточного фундамента;
  • БФ – железобетонный ленточный элемент из тяжёлого бетона, используется при возведении внутренних и наружных стен здания для промышленных и сельхоз нужд;
  • ФР – железобетон из утяжелённого бетона для трёхшарнирных рам.

Попытаемся теперь разобраться, какой бетон чаще всего используется. Ленточные фундаменты – это, в первую очередь, строительные конструкции, которые работают преимущественно по сжатию (за исключением фундаментных подушек). Поэтому, необходимости применения высоких марок и классов бетона практически нет. Обратимся к ГОСТу 13579-78: максимальным классом прочности на сжатие будет В15 или же бетон с маркировкой М-200. Минимальным классом для керамзитбетонной продукции или тяжёлого бетона считаем В3,5 или маркировки М-50. И минимальным классом для изделий из силикатного бетона – В12,5 или марки М-150.

В большинстве случаев, для фундамента выбирается утяжелённый цементный бетон В7,5 для блоков видов ФБВ и ФБС. Для более слабых ФБП необходим куда более прочный материал типа В12,5.

Чтобы знать какой размер фундаментных блоков вам необходим для строительства, необходимо заранее начертить схему, чертеж, где будут подробно указаны расположения всех блоков.

Маркировка фундаментных блоков

Рассмотрим маркировку фундаментных блоков. Последующие цифры после первых букв означают длину, ширину и высоту блока. Учитывайте, что параметры обычно завышены на 20 мм.

Например, ФБС -24-3-6, длина – 2380мм, ширина – 300мм, высота – 580 (20 мм).

В зависимости от марки бетона вес блока может меняться.

Блоки из тяжелого бетона с армированием, называются фундаментными подушками, сокращенно ФЛ. Их используют при постройке ленточных фундаментов, для жилых высотных зданий. В связи с большой нагрузкой, выдерживаемой блоками ФЛ, при изготовлении к ним выдвигаются высокие требования точности размеров и качества материала. Железобетонные фундаментные блоки способны выдерживаться сейсмическую активность в 9 балов, имеют высокую устойчивость к температурным колебаниям и коррозии.

Размер фундаментных блоков ФЛ определяет ГОСТ 13580-85.

Таблица размеров ФБС блоков

Выбор фундаментных блоков для строительства

Вид фундаментных блоков выбирается в зависимости от следующих параметров:

Обычно на длину одной стены рассчитывают 4-5 блоков ФБС. Для влажных и глинистых грунтов выбирается крупногабаритные фундаментные блоки ФБС, а для сухих, где закладка выполняется на глубине 60-70 см, применяют средние ФБС.

Для строительства небольших домиков, дач, баней, коттеджей используют фундаментные блоки по размеру 40х20х20 мм. Их можно укладывать вручную, без использования спец техники. Благодаря удобным размерам фундаментный блок 20х20х40 используют не только при укладке фундамента, но и при возведении стен здания.


Фундаментные блоки (ФБС) от производителя

Фундаментные блоки используются при возведении стен подвалов и элементов ленточных фундаментов. Основное назначение фундаментных блоков - перераспределение всей нагрузки здания на фундамент.

Среди основных преимуществ фундаментных блоков:

  • Долговечный
  • Надежность
  • Высокое качество изделий

Фундаментные блоки сплошного сечения для стен подвала выполнены из тяжелого бетона марки В7,5 и морозостойкости F50.По дополнительному согласованию блоки могут изготавливаться из бетона другой марки.

ПРИМЕНЕНИЕ БЛОКОВ

Фундаментные блоки из бетона - разновидности железобетонных изделий, непосредственным назначением которых является закладка фундамента. Более того, их используют для строительства подвальных помещений, различных перегородок, навесов. Их используют в аграрном секторе, например, при строительстве комплексов. Блоки используются при возведении стен тоннелей. Есть еще несколько способов применения фундаментных блоков: защита дорог, ремонт дорог, рекультивация берегов в случае разрушительных наводнений.Военные используют блоки ФБС для возведения защитных сооружений, заграждений.

ПРЕИМУЩЕСТВА ФУНДАМЕНТОВ
  • Экономия времени, так как нет необходимости смешивать бетон и соблюдать пропорции. Установка очень быстрая;
  • Прочность конструкции. Некоторые типы могут иметь специальные врезки, укрепляющие конструкцию;
  • Блок устойчивы к морозам, кислым почвам подпитываются специальными средствами;
  • Специальные крючки позволяют облегчить установку основания.

НЕДОСТАТКИ
  • Это дорогой материал. Для его установки вам понадобится строительная техника.
  • Есть возможность просадки фундамента. Структура не цельная. Это означает, что каждый блок может вести себя по-разному.

ВИДЫ ФУНДАМЕНТОВ
  • бетон силикатный;
  • бетон керамзитовый;
  • армированный бетон.

При изготовлении силикатного бетона добавляется известь.Раствор будет умеренным по весу. Блоки маркируются буквой S . Вес продукта колеблется от 290 кг до 1,7 тонны. Согласно ДСТУ, этот тип нельзя использовать в условиях повышенной влажности, следовательно, нельзя использовать в качестве фундамента.

При изготовлении керамзитобетона в раствор добавляют керамзит (керамзит). Сам керамзит - это пористый материал. Поэтому эта пропорция самая легкая, вес блока от 250 кг до 1,5 тонны.Товар будет обозначен буквой L , то есть легкий. Низкая цена, высокое водопоглощение и низкая прочность - все это свойственно керамзитобетону. Его можно использовать для строительства легких зданий.

Железобетонные блоки имеют большой вес за счет плотности материала. Вес колеблется от 250 кг до 2 тонн. Он отмечен буквой Т, что означает тяжелый. Он предназначен для многоэтажных домов.

Фундаментные блоки различают по форме, профилю, размерам.У них разная маркировка:

  • Прямоугольные блоки с ямками называются ФБС. Их используют при устройстве ленточного фундамента, устройстве малоэтажных стен.
  • Для монолитного фундамента используются пустотелые блоки. Они помечены как FBP. Блоки используются для строительства многоэтажных домов.
  • Могут быть как трапециевидного, так и прямоугольного сечения. Они помечены как BF.
  • Колонны цилиндрические для устройства изолированного фундамента и свайного фундамента.Они имеют маркировку F.
  • .
  • Блоки трапециевидной формы используются для ленточных и опорных фундаментов. Этот продукт отмечен знаком FO.

Цифры после блока - габаритные размеры в дециметрах. Первая цифра означает длину, вторая - ширину, а последняя - высоту.

Обзор

FBS

Обзор FBS

FBS используется, когда есть опасность обратной связи в реальных ситуациях.FBS обнаруживает обратную связь на канале живого микрофона и использует набор до 5 фиксированных фильтров и 15 динамических фильтров для противодействия частотным пикам на обнаруженных частотах обратной связи.

См. Раздел для получения дополнительной информации.

Установка процессора FBS

  1. Откройте контекстное меню одним из следующих способов:
    • Дважды щелкните блок FBS (подавитель обратной связи) в рабочем пространстве DSP Configurator.
    • Щелкните правой кнопкой мыши блок FBS, чтобы открыть контекстное меню.
    • Щелкните блок FBS, чтобы выбрать его (или используйте клавиши со стрелками для перехода к блоку FBS), и нажмите клавишу на клавиатуре.
  2. В раскрывающемся меню выберите «Подавитель обратной связи». В качестве альтернативы, если вы щелкнули блок правой кнопкой мыши, выберите «Вставить подавитель обратной связи». Цвет блока FBS изменится на оттенок коричневого.

Чтобы настроить параметры FBS, дважды щелкните блок FBS.Откроется диалоговое окно «Подавитель обратной связи». См. Подраздел «Компоненты диалогового окна подавителя обратной связи» ниже для получения информации о параметрах, доступных в диалоговом окне. См. Раздел для получения информации о настройке FBS.

Компоненты диалогового окна «Подавитель обратной связи»

Диалоговое окно «Подавитель обратной связи» содержит следующие глобальные кнопки:

  • Очистить все - удаляет все настройки динамического фильтра
  • Заблокировать - этот параметр блокирует динамические фильтры в соответствии с текущими настройками, предотвращая обновление или перезапись фильтров.Это временный режим, который полезен при тестировании системы или при преобразовании динамических фильтров в фиксированные, чтобы динамические фильтры оставались чистыми до тех пор, пока вы не решите дополнительно вызвать систему.
  • Bypass FBS - Устанавливает все динамические фильтры в режим Bypass. Это не влияет на фиксированные фильтры.
  • Set Defaults - Сбрасывает все значения до пользовательских настроек по умолчанию

Диалоговое окно содержит следующие три вкладки элементов управления:

  • Настройки - Эта вкладка позволяет управлять глобальными настройками и параметрами просмотра.
  • Динамические фильтры - Эта вкладка позволяет управлять распределением динамических и фиксированных фильтров.
  • Фиксированные фильтры - Эта вкладка позволяет управлять параметрами фильтра.

Вкладка настроек

Следующие настройки доступны на вкладке «Настройки» диалогового окна «Подавитель обратной связи».

  • Для составного представления Показать - Устанавливает содержимое графического представления.Вы можете щелкнуть одну из следующих радиокнопок, чтобы отобразить соответствующий контент на графике.
    • Только динамические фильтры FBS
    • Только фиксированные фильтры FBS
    • Фиксированные и динамические фильтры FBS
  • Mode - Вы можете щелкнуть стрелки вверх и вниз или вручную ввести значение в поле Q, чтобы настроить режекторный фильтр Q, который используется динамическими фильтрами. Вы можете изменить настройку по умолчанию в Инструменты> Параметры (см. Раздел).

    Диапазон настройки составляет от 5 до 65. Большие значения обеспечивают меньшее изменение частотной характеристики звука, в то время как меньшее значение может обеспечить большее подавление обратной связи, но с большим возможным воздействием на тональную характеристику исходного звука. Предлагаемые значения для конкретных приложений следующие:

    • Q = 7 для голоса со значительным потенциалом обратной связи
    • Q = 30 для голоса с меньшим потенциалом обратной связи (по умолчанию)
    • Q = 65 для музыки с минимальным потенциалом обратной связи
  • Время атаки - Устанавливает время, в течение которого динамические фильтры генерируются после обнаружения обратной связи.Большее время атаки (время атаки 200 мс или более) уменьшает изменение, при котором музыка или аудиоконтент нежелательно запускают реакцию динамических фильтров.

    Короткое время атаки (время атаки 2 мс или меньше) сокращает время, в течение которого возникает обратная связь, прежде чем она будет обнаружена и подавлена.

  • Время удержания - Установите флажок Включить, чтобы включить время удержания, которое выражается в <часы>: <минуты>: <секунды> до девяти часов.Вы можете настроить время удержания, нажимая стрелки вверх и вниз или вручную вводя значения часов, минут и секунд. Время удержания устанавливает время, в течение которого параметр динамического фильтра сохраняется до его очистки. По истечении времени удержания фильтр очищается, и можно определить новую настройку. Обратите внимание, что когда фильтр очищается, обратная связь может возникать снова с той же частотой, что приводит к включению нового динамического фильтра.

    Когда время удержания отключено (флажок «Включить» снят), динамические фильтры действуют бесконечно, пока они не будут очищены вручную или пока вы не выключите и не выключите устройство.При отключении время удержания возвращается к 00:00:00.

Вкладка "Динамические фильтры"

Вкладка «Динамические фильтры» содержит пятнадцать динамических фильтров. Используйте полосу прокрутки для отображения фильтров, скрытых из-за размера окна. Значения частоты и среза отключены до тех пор, пока вы не сгенерируете фильтр. Динамические фильтры находятся в режиме автоопределения, когда активен блок FBS, то есть когда байпас отключен.После того, как значения фильтра установлены в соответствии с требованиями разработчика системы, вы можете нажать кнопку «Заблокировать», чтобы избежать дальнейших изменений настроек фильтра (необязательно). Блокировка динамических фильтров является временной и предназначена для использования во время настройки FBS. Когда вы закрываете диалоговое окно «Подавитель обратной связи», режим блокировки автоматически отключается.

Нажмите кнопку «Перейти к фиксированному», чтобы отправить назначенную настройку фильтра первому доступному фильтру на вкладке «Фиксированные фильтры», который автоматически очистит динамический фильтр.Нажатие кнопки «Очистить» отменяет все установленные параметры для соответствующего динамического фильтра. Очищенный фильтр возвращается в режим автоопределения (если кнопка блокировки нажата, это произойдет только после выхода из состояния блокировки).

Вкладка «Фиксированные фильтры»

Фиксированные фильтры неактивны и отображаются на вкладке Фиксированные фильтры. По умолчанию для типа фильтра установлено значение Не используется.Параметры фильтра не отображаются, если для типа фильтра установлено значение Не используется. Когда фильтр перемещается на вкладку «Фиксированные фильтры» из вкладки «Динамические фильтры», фильтр становится активным и отображает Notch в качестве типа фильтра (см. Изображение ниже). Фильтр также отображает все параметры (частоту, срез и добротность). После того, как фильтр активен как фиксированный, вы можете изменить настройки по мере необходимости, хотя обычно в этом нет необходимости.

Блокирование ICC / IF: Novus Biologicals

Ссылки по теме

Выбор флуорохромов для многоцветного ICC / IF

Подготовка образцов для экспериментов ICC / IF

Фиксация и стабилизация

Блокировка для анализа ICC-IF

Отбор антител

в ICC / IF

Методы обнаружения ICC IF

Контроли для экспериментов ICC / IF

Противокрашивание и монтаж

Полезные ссылки

Многоцветный протокол ICC / IF

Поиск и устранение неисправностей ICC / IF

Вторичные антитела

Маркер для органелл

Посмотреть все протоколы

Справочник ICC

Какова цель блокирующего шага в ICC / IF?

В ICC / IF обнаружение антигена зависит от специфического связывания антитела с его эпитопом.Это связывание, в свою очередь, регулируется гидрофобными взаимодействиями, ионными взаимодействиями, водородными связями и другими межмолекулярными силами. Помимо облегчения специфического связывания антиген-антитело, те же силы / связи притяжения также могут способствовать неспецифическому связыванию. Этап блокировки сводит к минимуму неспецифические взаимодействия, которые приводят к фоновому и ложноположительному окрашиванию (артефактам). Важно использовать реагенты и условия блокирования, которые снижают неспецифическое связывание, но при этом оказывают незначительное влияние на специфическое связывание антиген-антитело.

Каковы наиболее важные аспекты блокирования буферов?

  1. Блокирующий буфер должен содержать инактивированную нагреванием нормальную сыворотку того же вида, что и хозяин вторичного антитела. Другие, менее предпочтительные блокирующие агенты включают фетальную телячью сыворотку (FCS), бычий сывороточный альбумин (BSA), казеиновый белок, обезжиренное сухое молоко и желатин.
  2. Чтобы облегчить проникновение в клетку и минимизировать эффекты неспецифических гидрофобных взаимодействий, важно добавить неионный детергент (Triton X-100 или Tween 20) в блокирующий буфер, разбавитель антител и промывочные буферы.Блокирующие буферы обычно содержат 1X PBS с 0,1% Triton X-100 (PBS-T).
  3. Чтобы уменьшить неспецифические ионные взаимодействия, мы рекомендуем увеличить ионную силу фиксатора и / или разбавителя антител. Однако это не рекомендуется для буферов, содержащих моноклональные антитела, которые распознают один эпитоп, поскольку это может отрицательно повлиять на аффинность связывания

Состав блокирующих буферов

Блокирующий агент

Примечания для пользователя

Нормальная сыворотка

Сыворотка обычно разводится до конечной концентрации 5-10% в PBS-T.При непрямом обнаружении сыворотка должна быть из того же вида, что и хозяин вторичного антитела, или в случае прямого обнаружения может использоваться козья сыворотка.

BSA

BSA обычно растворяют до конечной концентрации 1-5% в PBS-T. Важно использовать БСА, свободный от эндогенных молекул IgG, поскольку они имеют тенденцию перекрестно реагировать со вторичными антителами и вызывать усиление фонового сигнала.

Сухое молоко

Сухое обезжиренное молоко растворяют в PBS-T до конечной концентрации 1%. Блокирование с помощью молока не рекомендуется для обнаружения фосфорилированных белков из-за высокого содержания фосфопротеинов, которые могут мешать окрашиванию и способствовать высокофоновому окрашиванию.

Широкоугольный ресивер

| Руководство по позиционированию в футболе

Физические измеримые параметры:

  • Высота: 6'2 "
  • Вес: 190 фунтов.

Статистика:

  • 40 ярдов: 4.5
  • Скамья: 235 фунтов.
  • Приседания: 315 фунтов.

Ключи от автобуса:

Должен быть постоянной угрозой каждый раз, когда он находится на поле. Должен иметь мгновенное освобождение от прямой видимости с низким уровнем площадки и небольшим бесполезным движением, рывком по маршруту, срезанием на один шаг, безупречной ловкостью и способностью отделиться от защитников с редкой максимальной скоростью и неуловимостью.Он должен уметь ловить спорной мяч так же легко, как столб, мелкий, наклонный или заминный. Он должен комфортно бегать по всем маршрутам, обладать редкими навыками владения мячом, иметь отличное сочетание размера и скорости, а также готовность блокировать. Он многолетний игрок государственного уровня, а в некоторых случаях - всеамериканский.


Физические измеримые параметры:

  • Высота: 6'0 "
  • Вес: 175 фунтов.

Статистика:

  • 40 ярдов: 4.6
  • Скамья: 225 фунтов.
  • Приседания: 295 фунтов.

Ключи от автобуса:

Должен иметь мгновенный выход из зоны прямой видимости с низким уровнем площадки, рывком по маршруту, срезанием на один шаг, выдающейся ловкостью и способностью отделяться от защитников своей скоростью. Он должен уметь ловить спорной мяч так же легко, как сетку, уклон или заминку. Он должен комфортно бегать по всем маршрутам, обладать очень хорошими навыками владения мячом и готовностью блокировать.Он получил награды Общегосударственных и Всеконференционных.


Физические измеримые параметры:

  • Высота: 5'10 "
  • Вес: 165 фунтов.

Статистика:

  • 40 ярдов: 4.6
  • Скамья: 205 фунтов.
  • Приседания: 275 фунтов.

Ключи от автобуса:

Должен иметь быстрое освобождение от прямой видимости, хорошее зрение и инстинкты, хорошие руки, скорость, чтобы защитники промахнулись.Он, как правило, очень спортивен, быстрее, чем быстр, или обладает скоростью, и он слишком мал для этой позиции. Он готов блокировать и играет с большим мотором. Он получил почетные звания всех конференций.


Физические измеримые параметры:

  • Высота: 5'8 "
  • Вес: 150 фунтов.

Статистика:

  • 40 ярдов: 4,7
  • Скамья: 200 фунтов.
  • Приседания: 265 фунтов.

Ключи от автобуса:

Должен уметь быстро выходить из строя, продавать маршрут игры, делать точные врезки в / из брейков, постоянно ловить мяч и, как правило, быстрее, чем быстро.У него должен быть как минимум 1 год студенческого футбольного опыта.

Сумма для начала торговли

Если вы хотите стать трейдером Форекс и хотите знать, сколько денег вам следует потратить на торговлю, вы пришли в нужное место. В этой статье мы объясним, какая минимальная сумма денег вам потребуется для торговли валютами.

Для начала помните, что существуют демо-счета, которые позволяют вам практиковаться в торговле, не вкладывая ни единого доллара.Размер демо-счета в FBS может достигать 1 миллиона долларов. Демо-счет позволит вам попрактиковаться в открытии ордеров и настройке размеров позиций.

Если вы готовы торговать с использованием реального счета и зарабатывать реальные деньги, вы должны знать, что сумма денег, необходимая для начала торговли, зависит от выбранного вами типа счета.

Например, , чтобы торговать на микро-счете, вам необходимо внести минимум 5 долларов. Вы сможете открывать ордера, объем которых начинается с 0.01 лот и используйте приличное кредитное плечо. Если вы планируете открывать много сделок, рассмотрите стандартный счет с плавающим спредом в 0,5 пункта. Этот тип учетной записи требует минимальных вложений в размере 100 долларов США. Обратите внимание, что вы можете открыть по одной учетной записи каждого типа. Чтобы иметь возможность открыть до 10 учетных записей любого типа, вам необходимо подтвердить свой личный кабинет, изменить метод подтверждения с электронной почты на SMS и убедиться, что общий депозит для всех учетных записей в вашем личном кабинете составляет 100 долларов США или более.

Размер вашей сделки определяется размером депозита

Минимальный размер сделки с FBS - 0.01 лотов. Лот - стандартный размер контракта на валютном рынке. Это равно 100 000 единиц базовой валюты, таким образом, 0,01 лота составляет 1000 единиц базовой валюты. Если вы покупаете 0,01 лота по EUR / USD и ваше кредитное плечо составляет 1: 1000, вам понадобится 1 доллар в качестве маржи для сделки. Если вы положили 5 долларов на микро-счет, ваш депозит покроет эту маржу, и вы сможете открыть еще 4 сделки такого размера. Каждый пункт движения цены либо принесет вам, либо будет стоить вам 0,1 доллара.

Рассмотрим несколько хороших вариантов для начинающего трейдера.Приведенные здесь примеры безопасны и надежны с точки зрения управления рисками.

Депозит = 100 $

Сумма риска для одной сделки не должна превышать 5%, независимо от размера вашего депозита. Пойдем с риском 3% (3 доллара). Если вы торгуете лотом 0,01, вы можете иметь стоп-лосс до 30 пунктов - этого более чем достаточно для внутридневной позиции. Рекомендуемое соотношение риск / прибыль составляет ⅓, поэтому потенциальная прибыль по этой сделке составит 90 пунктов (9 долларов США).

Депозит = 500 $

Что делать, если ваш депозит составляет 500 долларов? При 3% -ном риске (15 долларов США) размер вашей сделки может быть равен 0.15 лотов. В этом случае каждый пункт прибыли / убытка будет составлять 1,5 доллара. Чем больше размер позиции, тем быстрее вы сможете зарабатывать деньги! Будет 10 пунктов для Stop Loss. Если вам нужен более широкий стоп, вы можете торговать 0,1 лотом: тогда каждый пункт будет стоить 1 доллар. Stop Loss будет 15 пунктов. При 5% -ном риске (25 долларов) вы можете позволить стоп-лосс в 25 пунктов. Прибыль в этом случае (если ваш Take Profit в 3 раза больше) составит 75 долларов.

Депозит = 1000 $

Если ваш депозит составляет 1000 долларов, вы, конечно, сможете открывать еще более крупные сделки.Риск в 3% на сделку (30 долларов) и кредитное плечо 1: 1000 позволит вам торговать 0,3 лота. Риск 10% (100 $) позволит вам торговать 1 лотом. В этом случае 30 пипсов прибыли составят прибыль в 300 долларов. Оптимальный риск в 30 долларов на сделку позволит вам торговать 0,1 лотом с SL в 30 пунктов. Потенциальная выгода составит 90 долларов.

Еще одна важная вещь: помните о Margin Calls и Stop Outs. Margin Call - допустимый уровень маржи от 40% и ниже. На этом этапе компания имеет право, но не обязана закрывать все открытые позиции клиента из-за отсутствия свободной маржи.Stop Out - это минимально допустимый уровень маржи (20% и ниже), при котором торговая программа начнет закрывать открытые позиции клиента одну за другой, чтобы предотвратить дальнейшие убытки, которые приведут к отрицательному балансу (ниже 0 долларов США).

Если вы соблюдаете правила управления рисками и не вкладываете в торговлю сразу весь свой депозит, вы будете в безопасности от требований маржи и стоп-аутов.

Заключение

Как видите, для начала торговли вам нужно минимум 5 долларов. Остальное зависит от тебя! Оцените свои знания и опыт, а также подумайте о своих целях.Сколько денег вы хотели бы заработать? Как часто вы будете торговать? Чем больше депозит, чем больше размер позиции, тем больше вы заработаете с одной сделки. Все это следует взвешивать на фоне рисков.

Пожалуйста, убедитесь, что вы тратите только свои свободные деньги на торговлю, а не деньги, которые покрывают ваши основные жизненные потребности. Торговля предлагает отличные возможности для получения прибыли, но она рискованна и возможны убытки.

Всеамериканская команда 2021 года для студенческого футбола. Слишком рано.

После преодоления трудностей сезона студенческого футбола 2020 года, есть ли кто-нибудь, кто не хочет немного заглянуть в будущее?

Мы прощаемся с такими звездами, как ДеВонта Смит, Тревор Лоуренс, Джастин Филдс и Дэвион Никсон, но в следующем сезоне на футбольных полях колледжей появится целая группа игроков.Мы в ESPN подготовили для вас слишком раннюю сборную Америки в сезоне 2021 года.

Бегущий из штата Айова Брис Холл и игрок команды LSU Кейд Йорк - единственные, кто остался в команде ESPN All-America в сезоне 2020 года. Действующий чемпион страны Алабама - единственная школа, где в команду входят три игрока, и настоящий второкурсник в 2021 году будет особенно впечатляющим.

Вот что у нас получилось:

Offense

QB Сэм Хауэлл, Северная Каролина Tar Heels

За первые два сезона Хауэлл сделал больше передач тачдауна (68), чем Лоуренс за первые два сезона. Клемсон (66).Это довольно хорошая компания, и после второго сезона, когда Хауэлл ростом 6 футов и 225 фунтов прошел 3586 ярдов, 30 приземлений и семь перехватов, он мог бы задуматься о кампании Heisman Trophy в 2021 году. его лучший результат в конце игры, когда он забросил 19 тачдаунов и ни разу не перехватил мяч в четвертой четверти.

Сэм Хауэлл будет претендентом на Трофей Хейсман в юниорском составе Северной Каролины. Дуг Мюррей / Icon Sportswire

RB Breece Hall, Iowa State Cyclones

Hall возглавляет бригаду талантливых игроков, вернувшихся за Cyclones в следующем сезоне, и был одним из самых продуктивных бегунов колледжа в 2020 году на втором курсе.Зал 6-1, 215 фунтов привел всех игроков FBS с 1 572 ярдами и уступил только Наджи Харрису с 21 точным приземлением. Холл стал третьим на национальном уровне с восемью пробегами на 30 ярдов и более, а также поймал 23 передачи, в том числе две на приземления.

РБ Биджан Робинсон, Техас Лонгхорнс

Ищите 6-футового 222-фунтового Робинсона, который подберет прямо с того места, где он остановился, чтобы закончить свой сезон новичка, особенно с новым тренером Стивом Саркисяном, называющим игру. Избавившись от травмы спины, Робинсон начал последние шесть игр и показал потрясающие результаты - 220 или более ярдов в каждой из последних двух игр.В прошлом сезоне Робинсон в среднем набирал 8,9 ярда за касание, что соответствовало 14 играм команды на 20 и более ярдов.

WR Марвин Мимс, Оклахома Сунерс

Как истинный первокурсник, 5-11, 177-фунтовые Мимс были электрическими для Рано, давая представление о том, на что способен бывший четырехзвездочный проспект из Фриско, штат Техас. из. В прошлом сезоне Мимс установил рекорд первокурсника OU, поймав девять приземлений, а четыре из его результатов - не менее 45 ярдов. Спенсер Раттлер и Мимс сыграют одну из самых страшных комбинаций квотербека и широкого ресивера в стране в следующем сезоне.

WR Крис Олав, штат Огайо Баккейз

Планируемый как один из лучших принимающих на предстоящем драфте НФЛ, Олав отложил профессиональный футбол на другой сезон и объявил в понедельник, что возвращается в штат Огайо на свой старший сезон. В это межсезонье Баккейс не мог подобрать лучшего (или более талантливого) новобранца. Олаве - элитный спортсмен и взрывоопасен. Он был лучшим пассажиром Баккейз каждый из двух предыдущих сезонов и поймал семь пасов в семи играх 2020 года.

TE Исайя Скорее всего, Coastal Carolina Chanticleers

Chanticleers было очень интересно наблюдать за атакой в ​​прошлом сезоне, и снова должен быть квотербек Грейсон МакКолл, вернувшийся, чтобы бросить Вероятно, который был вторым в команде Coastal Carolina с 30 ловушками, включая пять, которые пошли на приземления. 6-4, 245-фунтовый Скорее всего, который год назад набирал в среднем 20 ярдов на улов, имеет размер, скорость и руки, чтобы стать кошмарным противником для любого полузащитника или защитника.

ОТ Эван Нил, Алабама Багровый прилив

В прошлом сезоне в студенческом футболе Алабама была ближе всего к линии нападения НФЛ. В то время как пара линейных игроков Tide перейдет в ряды профессионалов, Нил весом 6-7 кг возвращается в качестве одного из лучших снастей в стране. Он начал все 13 игр в 2020 году правым отбором и был стартовым игроком Tide в левом защитнике, как настоящий новичок в 2019 году. Где бы он ни выстраивался, он сила и главная причина, по которой Алабама снова должна доминировать впереди.

О.Г. Кеньон Грин, Техас A&M Aggies

Техасская линия нападения A&M в прошлом сезоне была ветеранским подразделением, но бойцом «Maroon Goons» с его левого защитного пятна был Грин весом 6–4 325 фунтов, который был назван несколькими командами All-America как истинный второкурсник. Грин помог Эджи проложить путь в среднем более 200 ярдов за игру, а также является отличным защитником пасов.

C Тайлер Линдербаум, Айова Хоукайз

Несмотря на то, что его оценил Мел Кипер-младший.В качестве центрового № 2, подходящего для драфта, Линдербаум хотел добиться большего в Айове и вернулся в свой юношеский сезон в красной рубашке. Двухлетний игрок «Соколиного глаза», 6–3, 290 фунтов Линдербаум, в прошлом сезоне стал финалистом «Римингтон Трофи», который достается лучшему центру в студенческом футболе.

О.Г. О'Кайрус Торренс, Луизиана Рэджин-каджунс

Не спите на линии нападения Луизианы в следующем сезоне, когда будете оценивать лучшие линии американского футбола. 6-5, 332 фунта Торренс - лучший из группы в правом защитнике.Когда-то он весил более 400 фунтов, прежде чем прибыть в Лафайет, но затем стал одним из лучших линейных игроков в внутренней атаке в стране. По прозвищу «Сайбо» Торренс играл в стартовом составе каждый из своих первых двух сезонов за Ragin 'Cajuns.

ОТ Дариан Киннард, Кентукки Wildcats

Киннард был огромным пикапом для Wildcats, когда они подписали его как желанного кандидата из Огайо, и он был всем, на что они надеялись, а затем и некоторыми. Киннард, весивший 6-5 фунтов, 345 фунтов, думал о том, чтобы стать профессионалом, но решил вернуться в свой взрослый сезон и снова закрепит атакующую линию Кентукки с правильной позиции для захвата.

2 Связанные

Универсальный Дьюс Вон, штат Канзас Wildcats

После звездного сезона новичка Вон вернулся в качестве версии швейцарского армейского ножа для Wildcats. Он мчался на лидирующие в команде 642 ярда и семь приземлений, поймал лидирующие команды 25 передач, в среднем 17,4 ярда за улов, а также в среднем 20,7 ярда при семи ответных ударах. Вон 5-5, 168 фунтов, присоединился к Харрису и Трэвису Этьену как единственные трое игроков FBS в 2020 году, которые мчатся на более чем 600 ярдов и имеют более 400 приемных ярдов.

Защита

DL Майлс Мерфи, Клемсон Тайгерс

Травмы на конечной позиции защиты вынудили Клемсона сыграть с более молодыми игроками в 2020 году, включая Мерфи. Он дал обещание, которое все предсказывали, когда подписал контракт с «Тиграми». Как истинный новичок, Мерфи весом 6-5 фунтов стерлингов 275 фунтов возглавил команду, сделав 12 отборов на поражение, а также имел восемь прессинговых защитников. У Мерфи есть все необходимое, чтобы стать одним из лучших защитников страны в 2021 году.

DL Брайан Брези, Клемсон Тигерс

Молодой защитный талант Клемсона трудно было упустить в прошлом сезоне, а 300-фунтовый Брези 6-5 был удостоен награды ACC Defensive Rookie of the Year. Брези, получивший звание лучшего защитного снаряда ESPN в стране, вошел прямо в стартовый состав Клемсона и стал лидером команды с 11 нападающими защитниками. Он также имел 6,5 отборов на поражение, включая четыре мешка, и дает «Тиграм» доминирующее присутствие в середине их оборонительной линии.

DL Джордан Дэвис, Джорджия Бульдогз

Некоторые внутренние защитные линейные игроки берутся за двойные команды, и есть еще 6-6 330-фунтовый Дэвис. Он пожирает двойные команды, не говоря уже о игроках с мячом и квотербеках. Дэвис отказался от возможности принять участие в драфте НФЛ и вместо этого решил вернуться в свой взрослый сезон. Он не из тех, кто делает большие отборы, но его настоящая ценность заключается в том, что он разбивает лузу при каждой игре.

DL Kayvon Thibodeaux, Oregon Ducks

После настоящего сезона новичков, когда 6-5, 250-фунтовые Тибодо поразили всех в Pac-12 с девяти мешками, он вернулся в сокращенный сезон. в 2020 году и был столь же разрушительным.Тибодо сочетает в себе мощь и скорость в качестве пас-броска, но также является защитником, который делает невыносимым жизнь нападающим линейным игрокам во время беговых игр.

Кайвон Тибодо, защитник ростом 6 футов 5 дюймов и весом 250 фунтов, возглавил «Орегон» с тремя мешками в сокращенном сезоне 2020 года. Коди Гленн / Icon Sportswire

LB Уилл Андерсон младший, Алабама Crimson Tide

Андерсон весом 6–4 кг - последний из бесконечного списка талантливых полузащитников, участвовавших в программе Алабамы.Он был потрясающим новичком в Crimson Tide и финишировал вторым в команде с 10,5 отборами за проигрыш и семью мешками. С того момента, как Андерсон вошел в кампус, тренеры восторженно отзывались о его способностях и трудовой этике, и он только начал.

LB Девин Ллойд, Юта Юта

Защита «Утеса» получила огромный импульс, когда в начале этого месяца Ллойд объявил, что вернется в свой старший сезон. Финалист премии Буткуса среди юниоров, 6-3, 232 фунта Ллойд имел 10 отборов мяча в пяти играх и был одним из лучших плеймейкеров Pac-12 в защите.Ллойд снова станет капитаном обороны штата Юта, который должен вернуть все 11 игроков в стартовом составе в 2021 году.

LB Майк Роуз, штат Айова Циклоны

Возвращение «12-ти лучших защитников года» в следующем сезоне - всегда приятный бонус, и это Одна из нескольких причин, по которым Cyclones возлагают столь высокие ожидания на 2021 год. Роуз весом 6–4 фунтов 245 фунтов лидировал в юниорском штате Айова с 96 отборами, включая 10,5 отборов, а также перехватил пять передач. Его руководство в раздевалке неоценимо.

CB Tiawan Mullen, Indiana Hoosiers

Будучи второкурсником, Маллен стал первым защитником из Индианы в истории программы, получившим награды за первую команду All-America. Он сочетает в себе отличные навыки освещения и умение играть в бега. 176-фунтовый Маллен 5-10 финишировал с 3,5 мешками, тремя перехватами и одним вынужденным рывком в восьми играх прошлого сезона.

CB Джош Джобе, Алабама Багровый прилив

Большую часть прошлого сезона Джоба затмил выступавший в НФЛ Патрик Сюртейн II.Но со счетом 6-1, 192 фунта Джобе был так же эффективен, как и Сюртейн в передаче пасов, и вернулся в свой взрослый сезон, чтобы возглавить второстепенный игрок в Алабаме, который снова будет талантливым. Джобе был шестым в команде с 55 отбором мяча и вторым после Сюртейна с 11 передачами.

S Брэндон Джозеф, Northwestern Wildcats

Защита Northwestern была тяжелой задачей в 2020 году. Wildcats финишировали пятыми в национальном масштабе по результативности защиты, а Джозеф был ластиком на заднем плане. Первокурсник в красной рубашке 6-1, 192 фунта имел шесть перехватов, в том числе один из самых ярких моментов в проигрыше в чемпионате Big Ten от штата Огайо.У него были одни из лучших своих игр в крупнейших играх Wildcats, и он готовится к еще большему второкурснику.

С Кайл Хэмилтон, Нотр-Дам Файтинг ирландец

Иеремия Овусу-Корамоа был не единственным стойким защитником Нотр-Дама в прошлом сезоне. 6-4, 219 фунтов Хэмилтон был опорой его позиции безопасности на втором курсе и возглавил Fighting Irish с 63 общими отборами, включая 51 одиночный отбор. Он - универсальный защитник, о котором квотербек из Алабамы Мак Джонс сказал, что вам лучше всегда помнить о нем, потому что в противном случае он может «испортить вам игру»."

Специальные команды

K Кейд Йорк, LSU Tigers

Какая роскошь для атакующего LSU - иметь возможность перемещаться внутри 40-ярдовой линии противника и знать, что Йорк - это деньги с такого расстояния. Второкурсник из McKinney, Техас, забивал мяч с игры на 50 ярдов или больше в шести из 10 игр LSU в прошлом сезоне. Он был 9 из 11 на расстоянии 40 ярдов и более и 18 из 21 в целом. Его школьный рекорд в 57 ярдов поднял LSU на уровень выше. Самая большая победа сезона, поражение Флориды 37-34.

P Лу Хедли, Miami Hurricanes

Хедли был одним из трех финалистов в прошлом сезоне на премию Рэя Гая как лучший игрок в студенческом футболе, заняв второе место в национальном масштабе с 47.В среднем 3 ярда. Бывший игрок Австралийского футбола по правилам, 6-4, 220-фунтовый Хедли имел 19 пантов на 50 ярдов и более, а «Харрикейнз» лидировали все команды FBS в регулярном сезоне по сетке.

KR Маркус Джонс, Хьюстон Кугарс

Корнербэк первой команды All-AAC, Джонс в прошлом сезоне лидировал среди юниоров FBS по количеству ударов, возвращаемых пунтом (337) и среднему результату (19,8 ярда за возврат). 5-8, 185-фунтовый Джонс откатился на 72 ярда для приземления против Южной Флориды.Он был единственным игроком FBS, который провел по крайней мере две игры со 100-ярдовыми возвратами на пант, а также в среднем 20,4 ярда при пяти ответных ударах.

Лизат тромбоцитов человека как альтернатива фетальной бычьей сыворотке для культивирования и эндотелиальной дифференцировки мезенхимальных стволовых клеток околоплодных вод человека

Введение

Мезенхимальные стволовые клетки (МСК) рассматриваются как многообещающий инструмент для клеточной терапии. Амниотическая жидкость - источник мезенхимальных стволовых клеток, что вызывает все больший интерес.Человек МСК амниотической жидкости (hAF) можно выделить из околоплодных вод второй триместр беременности путем амниоцентеза, минимально инвазивная процедура. hAF-MSC составляют 0,9–1,5% клеточного популяции в околоплодных водах (1,2). В виде hAF-MSC могут вызывать остеогенные, хондрогенные, адипогенные, миогенные, эндотелиальные, печеночные или нейрогенные клоны (3), они показали свою эффективность в лечение многих заболеваний (4). Из-за эндотелиальной дифференцировки потенциал МСК, они получили значительное количество внимание как аутологичный источник клеточной терапии в восстановление эндотелиальных функций и содействие васкуляризации (5,6).

В процессе выращивания изоляция и протоколы расширения используют FBS в качестве дополнения, поскольку она использовалась в несколько клинических испытаний (7). Пока FBS содержит различные факторы роста, гормоны и питательные вещества. (8), он также обладает высокой эндотоксина и может быть потенциальным источником микробного загрязнители, включая грибы, бактерии, вирусы и прионы. Таким образом, клинические испытания и будущее терапевтическое применение МСК человека Следует стремиться избегать использования сывороток животного происхождения (9).Исследования вызвали обеспокоенность по поводу возможность передачи патогенов животным во время культивирования и процессы трансплантации (7,10). Кроме того, сообщалось, что пациенты, получившие при трансплантации клеток с МСК, увеличенными в FBS, обнаруживаются антитела против бычьих антигенов (11). Поэтому в качестве альтернативы использованию FBS для обеспечения питательными веществами и роста факторы (12).

Лизат тромбоцитов человека (hPL) был предложен в качестве альтернатива животной сыворотке для распространения МСК в vitro (13).hPL содержит различные факторы роста, включая фактор роста тромбоцитов (PDGF), трансформирующий фактор роста (TGF) и рост эпидермиса фактор (EGF) (11). Этот рост было показано, что факторы увеличивают скорость пролиферации МСК и сохраняют свой потенциал многолинейной дифференциации при культивирование в отсутствие ФБС (9). Биоактивные молекулы и факторы роста содержащиеся в hPL, как было показано, поддерживают расширение MSC происходит из костного мозга (КМ) (12), пуповинной крови (14) и жировой ткани (10).Кроме того, сообщалось о hPL. для индукции эндотелиальной дифференцировки BM-MSC (15).

На основании соответствующих данных (9,10,12,14,15), В настоящем исследовании изучалось использование FBS или hPL в качестве добавка для клеточных культур и сравнила характеристики hAF-MSC в этих условиях. Настоящее исследование сосредоточено на потенциал эндотелиальной дифференцировки AF-MSC, когда они были индуцированный фактором роста эндотелия сосудов (VEGF) с добавлением с FBS или hPL.

Материалы и методы
Препарат тромбоцитов человека лизат

Человеческие донорские тромбоциты (n = 15) были получены из банк крови больницы Махарадж Накорн Чиангмай с использованием тромбоцитов метод афереза ​​после положительного скрининга на антитела к эритроцитам.Впоследствии hPL был подготовлен в соответствии с ранее описанный метод (8). Вкратце, 15 объединенные группы тромбоцитов замораживали при -80 ° C, а затем оттаивали при 37 ° С; это повторилось трижды. Для удаления фрагментов мембраны, лизат центрифугировали при 2200 × g при комнатной температуре в течение 20 мин и супернатант фильтровали через фильтр 0,2 мкм. (Corning Inc.). Аликвоты лизата тромбоцитов хранили в −20 ° С. Чтобы избежать образования геля hPL, 2 Ед / мл гепарина (LEO Pharma A / S) был добавлен как антикоагулянт.

Анализ жизнеспособности клеток МТТ

MTT (каталожный номер 298-93-1; Sigma-Aldrich; Merck KGaA) был использован для оценки оптимальных концентраций hPL. hAF-MSC высевали в 96-луночный планшет по 5 × 103 клеток в повторить трижды и инкубировать при 37 ° C с 5% CO2 и 95% влажность в течение 24 ч. Клетки культивировали с DMEM с высоким содержанием глюкозы. (Gibco; Thermo Fisher Scientific, Inc.) с добавлением hPL (2,5, 5, 10, 20 или 40%) на 24, 48 или 72 часа. В качестве контроля клетки были культивированные только с DMEM, не содержащие ни FBS, ни hPL.На в указанные временные точки среда была удалена и заменена на МТТ раствор (0,5 мг / мл в DMEM). Еще через 4 часа инкубации в тех же условиях, что и для культивирования, раствор МТТ удаляли и добавляли 100 мкл ДМСО для растворения кристаллов формазана. В оптическую плотность определяли при 540 нм с помощью спектрофотометра.

Подготовка клеток и культивирование

Образцы клеток околоплодных вод человека с нормальным кариотип был получен в течение 16–22 недель беременности от Лаборатория генетики человека кафедры анатомии факультета Медицина, Университет Чиангмая.Это исследование было одобрено Комитет по этике исследований медицинского факультета, Чиангмай Университет 13 марта 2018 г. (№ ANA-2561-05343).

Собранные клетки культивировали с BIOAMF-3 ™. Полная среда (биологическая промышленность) площадью 25 см2 колба для культивирования (Corning Inc.) при 37 ° C, 5% CO2 и 95% влажность в течение 9 дней в лаборатории генетики человека для повседневной пренатальная диагностика. После получения клеток среду удаляли, и клетки промывали стерильным PBS. Они тогда были отсоединился от колбы с 0.25% трипсин-ЭДТА (Gibco; Thermo Fisher Scientific, Inc.) и культивировали в основной питательной среде: DMEM-высокий уровень глюкозы с гентамицином, пенициллином и стрептомицином, и с добавлением FBS (каталожный номер 16000036; Gibco; Thermo Fisher Scientific, Inc.) или hPL. Добавлена ​​основная питательная среда. с 10% FBS, 10% hPL или 20% hPL. Плотность клеток каждого группа была доведена до 105 клеток / см2 в колба для культивирования. Затем клетки инкубировали при 37 ° C, 5% CO2. и 95% влажности. Среду меняли каждые 3 дня.На достигнув 80% слияния, адгезивные клетки пассажа 1 были отделены с использованием 0,25% трипсина-ЭДТА. Определение пролиферации клеток и характеристика была выполнена после двух пассажей.

Клеточная пролиферация

hAF-МСК высевали на 24-луночный планшет (Corning Inc.) при плотности 104 кл. / См2. Они затем культивировали в основной среде с 10% FBS, 10% hPL или 20% hPL (10% FBS использовался в качестве контроля в этом эксперименте) при 37 ° C, 5% CO2 и 95% влажность. Подсчитывали клетки в сутки 0 и 1 день, а затем каждый второй день до 21 дня после посева с помощью гемоцитометра.

Проточная цитометрия

Для характеристики hAF-MSC маркеры клеточной поверхности клеток, культивируемых в основной среде, содержащей 10% FBS или 10% hPL, были оценен. Клетки трипсинизировали 0,25% трипсином-ЭДТА при 37 ° C в течение 1 мин и центрифугирование при 2035 × g в течение 6 мин при комнатной температуре. температура для получения гранул клеток. Затем неспецифическое связывание блокировали с использованием 10% человеческой сыворотки AB [сыворотка от доноров типа AB; обработано в нашей лаборатории и инактивировано при 53 ° C в течение 90 мин как описано ранее (16)] при 4 ° C на 30 мин.Впоследствии их инкубировали со следующими моноклональные антитела: мышиные антитела против CD34-FITC человека (номер по каталогу 343504; BioLegend, Inc.), CD44-FITC (номер по каталогу 21810443; ImmunoTools GmbH), CD45-фикоэритрин (PE; номер по каталогу 304008; BioLegend, Inc.), CD73-PE (№ по каталогу 21270734; ImmunoTools GmbH), HLA-ABC-FITC (№ по каталогу. 21159033; ImmunoTools GmbH) и HLA-DR-PE (номер по каталогу 21388994; ImmunoTools GmbH). Обнаружена экспрессия маркеров клеточной поверхности. с помощью FACScan (BD Biosciences) и проанализировали с помощью CellQuest ™ Pro 9.0 (BD Biosciences).

Дифференциация hAF-MSC в эндотелиальные клетки

Для исследования дифференцировки эндотелия потенциал hAF-MSC, клетки высевали в основную среду с добавлением 10% FBS или 10% hPL при плотности 104 клеток / см2 в 24-луночном планшете и индуцировали VEGF (кат. нет. V7259; Сигма-Олдрич; Merck KGaA) на 14 дней. Они тогда были субкультивировать на две группы и культивировать в основных средах с добавлением 10% FBS и 50 нг / мл VEGF или 10% hPL и 50 нг / мл VEGF (n = 5).

Количественная обратная транскрипция (RT-q) ПЦР

Суммарная РНК клеток (неиндуцированная с добавлением FBS клетки, неиндуцированные клетки с добавлением hPL, индуцированные с добавлением FBS клетки и индуцированные клетки, дополненные hPL; n = 5) был извлечен с использованием набор для выделения мини-РНК Illutra RNAspin (GE Healthcare Life Наук). Затем была проведена первая цепь комплементарной ДНК (кДНК). синтезируется из тотальной РНК с использованием набора для синтеза кДНК Tetro (кат. нет. БИО-65043; Биолайн), согласно заводской инструкции.Вкратце, образцы инкубировали при 45 ° C в течение 30 мин, затем 85 ° C в течение 5 минут для прекращения реакции. Ген транскрипты измеряли с помощью SensiFAST ™ SYBR® Комплект No-ROX (номер по каталогу BIO-98005; Bioline) с 7500 Fast Real-Time Система ПЦР (Applied Biosystems; Thermo Fisher Scientific, Inc.). Праймеры для ПЦР, нацеленные на фактор фон Виллебранда (vWF), рецептор 2 VEGF (VEGFR2) и эндотелиальная синтаза оксида азота (eNOS). (Таблица I) (17). Протокол состоял из 36 циклов. 30 секунд денатурации при 95 ° C, 30 секунд отжига при 60 ° C и 60 секунд удлинения при 72 ° C.GAPDH использовался в качестве внутреннего контроля. Уровень экспрессии генов, специфичных для эндотелия, был нанесен на график. методом 2 − ΔΔCq (18).

Таблица I.

Праймерные последовательности обратного транскрипционно-количественная ПЦР.

Таблица I.

Праймерные последовательности обратного транскрипционно-количественная ПЦР.

Праймер Последовательность
vWF
Вперед 5′-3 ′ CAAGGAAGAAAATAACACAGGTGAA
Реверс 5′-3 ′ TCATTGACCTTGCAGAAGTGAGTAT
VEGFR2
Вперед 5′-3 ′ GACTTCCTGACCTTGGAGCATCT
Реверс 5′-3 ′ GATTTTAACCACGTTCTTCTCCGA
eNOS
Вперед 5′-3 ′ TCCCCCAGAACTCTTCCTT
Реверс 5′-3 ′ CTCATTCTCCAGGTGCTTCA
GAPDH
Вперед 5′-3 ′ ATGGGGAAGGTGAAGGTCG
Реверс 5′-3 ′ TAAAAGCAGCCCTGGTGACC
Иммунофлуоресценция

Клетки из всех состояний (неиндуцированные и индуцированные клетки с добавкой FBS или hPL; n = 5) были проанализированы для экспрессия специфичных для эндотелия маркеров (vWF, VEGFR2 и eNOS).Вкратце, клетки дважды промывали PBS и фиксировали 4% параформальдегид при комнатной температуре в течение 15 мин. Они тогда были проницаемость 0,2% Triton X-100 (Amresco, LLC) в PBS в помещении температура в течение 10 мин. Затем блокирование неспецифического связывания было проведено с 10% сывороткой AB человека в 1% BSA-PBS в течение 30 мин в комнате температура с последующей инкубацией с мышиным моноклональным антителом против человеческого vWF (номер по каталогу MA5-14029; Pierce; Thermo Fisher Scientific, Inc.), кроличьи моноклональные антитела против человеческого VEGFR2. (Кот.нет. MA5-16417; Пирс; Thermo Fisher Scientific, Inc.) или мышиные моноклональные антитела против eNOS (номер по каталогу MA5-15559; Pierce; Thermo Fisher Scientific, Inc.) при 37 ° C в течение 2 ч при разбавлении 1: 200. После двукратной промывки клеток PBS конъюгированная с FITC коза антитело против IgG мыши (номер по каталогу 62-6511; Thermo Fisher Scientific, Inc.) или козьих антител против кроличьего IgG, конъюгированных с PE. (каталожный номер P-2771MP; Thermo Fisher Scientific, Inc.) были добавлены и инкубируют при 37 ° С в течение 1 ч при разведении 1: 500. Для ядерной При окрашивании клетки инкубировали с антифадом DAPI (2 мкл) в течение 10 мкл. мин при комнатной температуре (Invitrogen; Thermo Fisher Scientific, Inc.). Образцы были исследованы с использованием флуоресцентной лампы Olympus AX70. микроскоп и изображения были получены с помощью DP Manager и DP контроллер (увеличение × 20; Olympus Corporation). Статистическая анализ флуоресцентных сигналов проводился с помощью ImageJ 1.50i программное обеспечение (Национальные институты здравоохранения).

Формирование сети

Потенциал формирования сети оценивался инкубирование клеток из всех условий (неиндуцированных и индуцированных клетки с добавкой FBS или hPL; n = 5) в росте Матригеля матрица базальной мембраны с пониженным фактором (Corning Inc.), в соответствии согласно инструкции производителя. Вкратце, Матригель разморозили в 4 ° C в течение ночи и добавляли в 96-луночный планшет в концентрации 50 мкл / см2 с предварительно охлажденными наконечниками пипеток. Далее пластина была инкубируют при 37 ° C в течение 30 мин. После приготовления клеток клетки были подсчитали, и концентрацию довели до 2 × 105 клеток / 100 мкл. Затем клетки добавляли с выбранной плотностью к покрытые гелем лунки и инкубировали при 37 ° C, 5% CO2 и Влажность 95% в течение 24 часов. Эндотелиальная клетка пупочной вены человека (HUVEC) линия (Gibco; Thermo Fisher Scientific, Inc.) использовался как положительный контроль. Формирование сети наблюдалось под светом. микроскоп (увеличение × 20). Анализатор ангиогенеза ImageJ (http://image.bio.methods.free.fr/ImageJ/?Angiogenesis-Analyzer-for-ImageJ) был использован для анализа общей площади сетки и номера сетки.

Статистический анализ

Данные представлены как среднее значение ± стандартная ошибка среднее (n = 5 для всех экспериментов). Статистические сравнения были выполнено трижды с использованием теста Краскела-Уоллиса с апостериорным Тест Данна или U-критерий Манна-Уитни.Статистический анализ был выполняется с помощью программного обеспечения SPSS версии 22.0 (IBM Corp). P <0,05 считалось показателем статистически значимого разница.

Результаты
Анализ жизнеспособности клеток с помощью МТТ анализ

hAF-MSC культивировали в основных средах с добавками с hPL 2,5, 5, 10, 20 или 40% в течение 24, 48 и 72 часов. Результаты указали на повышение жизнеспособности клеток по сравнению с контролем при все моменты времени. Жизнеспособность клеток через 72 часа была значительно увеличена. по сравнению с 24 и 48 часами во всех условиях эксперимента, за исключением контрольного лечения (P <0.05; Рисунок 1).

Морфология hAF-MSC

При микроскопии установлено, что на 2 пассаже hAF-MSC, культивируемые в основных средах с добавлением 10% FBS, 10% hPL или 20% hPL плотно прилипли к колбе в монослое и имели гомогенную фибробластоподобную морфологию (рис. 2).

Пролиферация hAF-MSC

Кривая роста показывает, что количество клеток в каждое состояние (рис. 3) увеличивалось непрерывно в фазе регистрации без существенной разницы между условиями.Клетки с добавлением 10% FBS и 10% hPL вошли в стационарную фазу без существенных отличий в номере ячейки. Однако клетки с добавлением 20% hPL показали уменьшение количества ячеек между 11 и 15 днями. Меньшее количество ячеек поддерживалась между 13 и 21 днями.

Анализ экспрессии клеток поверхностные маркеры методом проточной цитометрии

Проточная цитометрия использовалась для характеристики экспрессия маркеров клеточной поверхности в hAF-MSC. Результаты показали, что экспрессия маркеров клеточной поверхности не различается. между клетками, культивируемыми в среде с добавлением 10% FBS, и 10% Носители с добавлением hPL.HAF-MSC из этих двух групп были положительный по CD44, CD73 и HLA-ABC, маркерам клеточной поверхности, которые экспрессируются hAF-MSC и отрицательны по CD34, CD45 и HLA-DR (Рис.4).

Морфология индуцированных hAF-MSC
Было индуцировано

hAF-MSC и разделено на две группы. (базовая среда с добавлением 10% FBS и 50 нг / мл VEGF или базовая среда среды с добавлением 10% hPL и 50 нг / мл VEGF). Через 14 дней воздействия VEGF в среде с добавлением 10% FBS или 10% hPL, оба набора клеток имели форму веретена.Однако овальный в окружающих прилипших клетках появились круглые пространства. hAF-MSC, культивированные в среде с добавлением hPL (фиг. 5).

Обнаружение гена, связанного с эндотелием выражение

Через 14 дней индукции VEGF экспрессия генов, связанных с эндотелием, включая vWF, VEGFR2 и eNOS, было определяли с помощью RT-qPCR (фиг. 6). Результаты показали, что уровни экспрессии vWF (фиг. 6A), VEGFR2 (фиг. 6B) и eNOS (фиг. 6C) были увеличены в Индуцированные клетки с добавлением FBS по сравнению с неиндуцированным контролем клетки, культивируемые в среде с добавлением FBS (2.66-кратный, 2,10-кратный и В 1,73 раза соответственно). Точно так же уровни этих генов были увеличено в индуцированных клетках, содержащих hPL, по сравнению с неиндуцированные контрольные клетки, культивируемые в среде с добавлением hPL (3,93 раза, 2,94 раза и 2,30 раза соответственно). Более того, уровни экспрессии vWF, VEGFR2 и eNOS были увеличилась в большей степени в индуцированных клетках, которые были культивировали с 10% hPL по сравнению с клетками, которые были культивированы с 10% FBS.

Экспрессия специфических для эндотелия маркеры

Была проанализирована экспрессия vWF, VEGFR2 и eNOS. как в индуцированных, так и в неиндуцированных условиях.Результат Иммунофлуоресцентный анализ показал, что индуцированные клетки культивировали либо с FBS, либо с hPL, экспрессирующими vWF, VEGFR2 и eNOS. Напротив, для этих белков в неиндуцированные условия при культивировании в средах с добавлением либо FBS, либо hPL (рис. 7A). Анализ с использованием программного обеспечения ImageJ 1.50i был использован для расчета скорректированная общая флуоресценция клеток (CTCF). Данные показали, что были значительные различия в уровнях CTCF для vWF (фиг. 7B), VEGFR2 (фиг. 7C) и eNOS (фиг.7D) между неиндуцированным и индуцированные клетки при культивировании с FBS или hPL. Анализ CTCF не выявили заметных различий между индуцированными клетками, культивированными в Среда с добавлением FBS или hPL (фиг. 7B-D).

Рисунок 7.

Обнаружение экспрессии эндотелиальные маркеры с использованием иммунофлуоресценции. Неиндуцированные клетки с добавлением FBS, неиндуцированные с добавлением hPL клетки, индуцированные клетки с добавлением FBS и индуцированные с добавлением hPL клетки окрашивали антителами против vWF, VEGFR2 или eNOS.Ядра клеток окрашивали DAPI (увеличение × 20; шкала 100 мкм). (A) Типичные изображения клеток, окрашенных на vWF, VEGFR2 и eNOS. Количественная оценка флуоресцентных сигналов с использованием скорректированных общая клеточная флуоресценция (B) vWF, (C) VEGFR2 и (D) eNOS. В U-критерий Манна-Уитни был использован для анализа результатов этого эксперимент * P <0,05. hPL, лизат тромбоцитов человека; vWF, фон Фактор Виллебранда; VEGFR2, фактор роста эндотелия сосудов рецептор 2; Эндотелиальная синтаза оксида азота eNOS.

Умение формировать сети

Образование сетей наблюдали с помощью светового микроскоп после инкубации клеток в планшетах, покрытых матригелем, для 24 ч.Неиндуцированные клетки как в условиях FBS, так и в условиях hPL не представляли сетевую структуру, в то время как Индуцированные клетки с добавлением FBS демонстрировали некоторую связь с клеточные процессы. Интересно, что индуцированные hPL-клетки показали формирование сети, которая была похожа на HUVEC (рис. 8A). Количественные данные были анализировали анализатором ангиогенеза, программное обеспечение ImageJ 1.50i. Данные представлены в виде общей площади ячеек (рис. 8B) и числа ячеек (рис. 8C) в индуцированных FBS-дополнениях. клетки, индуцированные клетки с добавлением hPL и HUVEC.В Тест Краскела-Уоллиса и апостериорный анализ показали, что количественная оценка двух параметров между тремя группами была обнаружена быть значительным.

Обсуждение

МСК были использованы в клеточной терапии для лечения или восстановить поврежденную ткань (4). Амниотическая жидкость является источником МСК, в которых клетки могут быть изолированы и легко расширяются (19). Хотя FBS широко используется для культивирования МСК, этот метод культивирования вызывает опасения по поводу потенциал передачи ксеногенного белка от сыворотки животного происхождения (13).Этот В настоящем исследовании изучались объединенные hPL в качестве замены FBS в культуральные среды hAF-MSC, с акцентом на потенциал hAF-МСК подвергаются эндотелиальной дифференцировке. ГПЛ была получен из концентрата тромбоцитов с помощью стандартизованных тромбоцитов метод афереза, обеспечивающий высокую концентрацию тромбоцитов и низкий уровень лейкоцитарной контаминации (20). Оптимальная концентрация hPL была оценивается с помощью теста МТТ. Результаты выявили значительные различия после культивирования hAF-MSC в среде с добавлением hPL на 72 ч; однако существенной разницы в показателях жизнеспособность клеток при каждой концентрации.На основании этих данных 10 и 20% hPL были выбраны для исследования мезенхимальных характеристики hAF-MSC.

Культура hAF-MSC со средами с добавлением 10% FBS, 10% hPL или 20% hPL выявили фибробластоподобную морфологию, в соответствии с предыдущими исследованиями (10,11,21). Настоящее исследование показало, что культивирование hAF-MSC в течение 21 дня в средах с 10% FBS или 10% hPL не выявили значимых различия в возможностях распространения. Тем не мение, способность к пролиферации снижалась в клетках, культивируемых с 20% hPL; этот результат не согласовывался с предыдущим исследованием (22).Это может указывать на вариации в компоненты hPL между партиями. Исследования показали, что есть многие факторы роста, содержащиеся в hPL, способствуют развитию МСК пролиферация и дифференцировка, включая основные фибробласты фактор роста (bFGF), EGF, инсулиноподобный фактор роста 1 (IGF-1), PDGF, VEGF и TGF-β (7,9,23). Как сообщалось в предыдущих исследованиях, hPL часто используется в концентрация 10% (9,24,25). Следовательно, эта концентрация была выбрана для оценки MSC. характеристики. Результаты экспериментов по проточной цитометрии показали, что hAF-MSC, культивированные с 10% FBS или 10% hPL, имели аналогичный уровень экспрессии маркеров клеточной поверхности.Данные представленные здесь, указывают на то, что добавление сред с hPL может поддерживать характеристики роста и фенотипический профиль hAF-МСК (26). Поэтому там возможность использования hPL вместо FBS в доклинические применения.

По свойствам МСК они способны дифференцировать согласно их мезодермальному происхождению. Предыдущий исследования показали возможность дифференциации hAF-MSC в остеоциты и хондроциты (27,28). В настоящем исследовании hAF-MSC, индуцированные с использованием VEGF, когда культивированные на средах с добавлением hPL были способны к эндотелиальному дифференциация.После 14 дней стимуляции VEGF hAF-MSC проявляли характеристики, подобные эндотелию. Индуцированная клетки, культивируемые в среде с добавлением FBS, плотно прилипали с фибробластоподобной морфологией. Напротив, клетки, культивируемые в СМИ дополненных hPL отображаются разные аранжировки, согласуется с другим исследованием (29). Анализ экспрессии генов с использованием RT-qPCR также продемонстрировала, что vWF, VEGFR2 и eNOS были экспрессированы. в индуцированных клетках, культивируемых в средах с добавлением FBS или hPL на более высоких уровнях, чем в неиндуцированных клетках.Более того, данные показали, что клетки культивировали с hPL и индуцировали с VEGF показали более высокий уровень экспрессии, чем индуцированные клетки культивировали с FBS. Эти результаты были дополнительно исследованы с использованием иммунофлуоресцентный анализ. Этот анализ показал, что там были специфические белки, экспрессированные в индуцированных клетках, культивированных с FBS или hPL. Эти результаты согласуются с предыдущим исследованием, в котором сообщили, что hPL может индуцировать экспрессию эндотелиальных маркеров (15). Лизат тромбоцитов был идентифицирован как мощный фактор индукции, потому что он содержит различные факторы роста, влияющие на созревание эндотелиальных клеток и рост (15).Это было сообщили, что VEGF и ангиопоэтин-1 в hPL стимулируют AKT путь, способствующий выживанию клеток и развитию сосудов в сердечно-сосудистая функция (30). Исследования также показали, что добавление в среду IGF-1, EGF и bFGF могут усиливать дифференцировку эндотелия потенциал индуцированных клеток (31–33).

Настоящее исследование также указывает на то, что индуцированное hAF-MSC могут формировать сети на Matrigel. Добавленные hPL индуцированные клетки сформировали сетевую структуру, которая были сопоставимы с таковыми, сформированными HUVEC.Это предполагает, что факторы роста, выделяемые тромбоцитами, могут способствовать ангиогенезу in vitro. Исследования показали, что hPL индуцирует васкулогенные и ангиогенные реакции при формировании эндотелиальных колоний клетки, опосредованные факторами роста, включая VEGF, bFGF и PDGF, приводя к образованию капиллярной сети (30,34). Ангиогенные эффекты могут быть активированы через путь ERK1 / 2 и путь ангиопоэтин-1 / Tie2 в ответ на уровень VEGF (35). Более того, эффект hPL обработка эндотелиальных клеток может стимулировать путь ERK1 / 2 к улучшают заживление ран, пролиферацию клеток и рост сосудов (36).Данные в настоящем исследования показывают, что hPL играет роль в дифференцировке hAF-MSC, поскольку они проявляли некоторые специфичные для эндотелия маркеры (vWF, VEGFR2 и eNOS) и образовывали капиллярные структуры. Следовательно, использование объединенных hPL может применяться в подходах, не содержащих ксеногенов. и стратегии улучшения васкуляризации.

Ограничением настоящего исследования является требование для получения дополнительной информации о концентрации факторов роста в hPL. Идентификация и количественная оценка различного роста факторов в hPL с помощью ELISA необходимо.Эффект от другого роста факторы, которые могут взаимодействовать с VEGF, также следует учитывать. В Кроме того, следует проводить более широкий профиль экспрессии. это также важно определить факторы и их концентрацию, присутствует в FBS и hPL. Наконец, также важно выяснить роль специфических факторов роста в эндотелиальном путь дифференцировки.

В заключение, настоящее исследование продемонстрировало что hAF-MSC можно культивировать в среде с добавлением hPL, в то время как поддержание пролиферации и иммунного фенотипа, а также увеличение потенциала дифференцировки эндотелия.Это предполагает что hPL может использоваться как альтернатива FBS. hPL также связаны с высокой степенью безопасности при использовании в клинических условиях разложение клеток и лечение сосудистых заболеваний.

Благодарности

Все клетки околоплодных вод человека были предоставлены Лаборатория генетики человека, Департамент анатомии и Таиланда Центр передового опыта в области тканевой инженерии и стволовых клеток, отделение биохимии медицинского факультета Чиангмайского университета. В Авторы выражают благодарность банку крови Махараджа Накорна Чанга Больница Май для поставки концентратов тромбоцитов.

Финансирование

Это исследование финансировалось Медицинским факультетом, Университет Чиангмая, Чиангмай, Таиланд (грант № ANA-2561-05343).

Наличие данных и материалов

Все данные, полученные или проанализированные в ходе этого исследования, включены в эту опубликованную статью.

Вклад авторов

WT и SA разработали эксперименты, а PP разработал эксперименты. KB, CP и NP внесли существенный вклад в дизайн исследования.SN проанализировал и интерпретировал данные. RM и TL собрали и проанализировали данные. КТ выполнила эксперименты. Документ был составлен WT, а рукопись была одобрено всеми авторами.

Одобрение этических норм и согласие на участвовать

Письменное информированное согласие было получено, и использованный протокол был одобрен этическим комитетом Медицинский факультет Университета Чиангмая 13 марта 2018 г. ANA-2561-05343).

Согласие пациента на публикацию

Не применимо.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересы.

Список литературы

1

Cananzi M, Atala A и De Coppi P: Стебель клетки, полученные из околоплодных вод: новые возможности регенеративного медицина. Репродукция Биомед онлайн. 18 (Дополнение 1): S17 – S27. 2009 г. Просмотр статьи: Google Scholar

2

Антонуччи I, Ступпия Л., Канеко Ю., Ю С, Тадзири Н., Бэ Е.К., Чхеда С.Х., Вайнбрен Н.Л. и Борлонган CV: амниотические жидкость как богатый источник мезенхимальных стромальных клеток для трансплантационная терапия.Трансплантация клеток. 20: 789–795. 2011 г. Просмотр статьи: Google Scholar: PubMed / NCBI

3

Чжоу Дж., Ван Д, Лян Т., Го Кью и Чжан G: Мезенхимальные стволовые клетки, полученные из околоплодных вод: характеристики и терапевтические приложения. Arch Gynecol Obstet. 290: 223–231. 2014. Просмотреть статью: Google Scholar: PubMed / NCBI

4

Вэй Х, Ян Х, Хань З.П., Цюй Ф., Шао Л. и Ши Ю.Ф .: Мезенхимальные стволовые клетки: новая тенденция в клеточной терапии.Acta Pharmacol Sin. 34: 747–754. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

5

Лю Дж. В., Дюнуайе-Гендр С., Серр-Бинье V, Mai G, Lambert JF, Fish RJ, Pernod G, Buehler L, Bounameaux H и Kruithof EK: Характеристика эндотелиально-подобных клеток, полученных из мезенхимальных стволовых клеток человека. J Thromb Haemost. 5: 826–834. 2007. Просмотр статьи: Google Scholar: PubMed / NCBI

6

Лидун Г., Шаоцин Л., Юньфан В., Хуэйминь Ю. Дацин Л., Лицзюань Х., Цысянь Б., Фанг Y и Сюэ Н.: In vitro. дифференцировка мезенхимальных стволовых клеток человека, полученных из жировой ткани в эндотелиально-подобные клетки.Chin Sci Bull. 51: 1863–1868. 2006 г. Просмотр статьи: Google Scholar

7

Витценедер К., Линденмайр А., Габриэла С., Höllera K, Theißa D, Redlb H и Hennerbichler S: человеческое происхождение альтернативы фетальной телячьей сыворотке в культуре клеток. Трансфус Мед Мать. 40: 417–423. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

8

Раух Ч., Фейфель Э., Аманн Э.М., Шпётль Х.П., Schennach H, Pfaller W и Gstraunthaler G: альтернативы использованию фетальной бычьей сыворотки: лизаты тромбоцитов человека в качестве заменителя сыворотки в средах для культивирования клеток.АЛЬТЕКС. 28: 305–316. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

9

Хемеда Х., Гибель Б. и Вагнер В. Оценка лизата тромбоцитов человека по сравнению с фетальной бычьей сывороткой для культура мезенхимальных стромальных клеток. Цитотерапия. 16: 170–180. 2014. Просмотреть статью: Google Scholar: PubMed / NCBI

10

Naaijkens B, Niessen HW, Prins HJ, Krijnen PA, Kokhuis TJ, de Jong N, Van Hinsbergh VW, Kamp O, Helder MN, Musters RJ и др.: Лизат тромбоцитов человека в виде фетальной бычьей сыворотки. заменитель улучшает культуру стромальных клеток, полученных из жировой ткани человека, для будущие приложения для восстановления сердца.Cell Tissue Res. 348: 119–130. 2012. Просмотр статьи: Google Scholar: PubMed / NCBI

11

Антонинус А.А., Вдовати В., Виджая Л., Агустина Д., Пурадишастра С., Сумитро С.Б., Видодо М.А. и Бахтияр I. Лизат тромбоцитов человека усиливает распространение вируса Уортона. мезенхимальные стволовые клетки, полученные из студня. Биомаркеры Genomic Med. 7: 87–97. 2015. Просмотр статьи: Google Scholar

12

Бибак К., Хеккер А., Коджаомер А., Ланнерт H, Schallmoser K, Strunk D и Klüter H: Человеческие альтернативы фетальная бычья сыворотка для размножения мезенхимальных стромальных клеток из костного мозга.Стволовые клетки. 27: 2331–2341. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

13

Дусет К., Эрноу И., Чжан И, Лленсе-младший, Begot L, Holy X и Lataillade JJ: лизаты тромбоцитов способствуют Экспансия мезенхимальных стволовых клеток: безопасный заменитель животных сыворотка в приложениях клеточной терапии. J. Cell Physiol. 205: 228–236. 2005. Просмотр статьи: Google Scholar: PubMed / NCBI

14

Аванзини М.А., Бернардо М.Э., Комета А.М., Perotti C, Zaffaroni N, Novara F, Visai L, Moretta A, Del Fante C, Вилла Р. и др.: Создание мезенхимальных стромальных клеток в присутствие лизата тромбоцитов: фенотипическое и функциональное сравнение предшественников из пуповинной крови и костного мозга.Haematologica. 94: 1649–1660. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

15

Хомаюни Могхадам Ф, Тайеби Т., Моради А, Надри Х., Барзегар К. и Эслами Г.: лечение лизатом тромбоцитов. индуцирует эндотелиальную дифференцировку мезенхимального ствола костного мозга клетки под жидким напряжением сдвига. ИСКЛЮЧЕНИЕ J. 13: 638–649. 2014.PubMed / NCBI

16

Солтис Р.Д., Хас Д., Моррис М.Дж. и Уилсон ID: Влияние тепловой инактивации сыворотки на агрегацию иммуноглобулины.Иммунология. 36: 37–45. 1979. PubMed / NCBI

17

Танчароен В., Аунгсучаван С., Потачароен П, Маркми Р., Наракорнзак С., Киоди Дж., Бунма Н. и Тасуя В.: Дифференциация мезенхимальных стволовых клеток из околоплодных вод человека эндотелиальным клеткам сосудов. Acta Histochem. 119: 113–121. 2017 г. Просмотр статьи: Google Scholar: PubMed / NCBI

18

Ливак К.Дж. и Шмитген Т.Д.: Анализ данные об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метод 2 (-Delta Delta C (T)).Методы. 25: 402–408. 2001 г. Просмотр статьи: Google Scholar: PubMed / NCBI

19

Фэй Х, Цзян С., Чжан С., Ли И, Ге Дж, Хэ Б, Гольдштейн С. и Руис Г.: изоляция, культура и идентификация мезенхимальные стволовые клетки, полученные из околоплодных вод. Cell Biochem Биофиз. 67: 689–694. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

20

Наску М.С., Самнер С.М., Чокалло А, Кемелмахер Х., Торесен М., Копленд I, Галипо Дж. И Перони Дж. Ф .: Лизат тромбоцитов как новая бессывороточная добавка к средам для культура мезенхимальных стволовых клеток, полученных из костного мозга лошадей.Корень Cell Res Ther. 9: 752018. Просмотр статьи: Google Scholar: PubMed / NCBI

21

Schallmoser K, Bartmann C, Rohde E, Райниш А., Кашофе К., Штадельмайер Э., Дрекслер К., Ланцер Г., Линкеш W и Strunk D: лизат тромбоцитов человека может заменить эмбрион крупного рогатого скота сыворотка для расширения функциональных мезенхимальных стромальные клетки. Переливание. 47: 1436–1446. 2007. Просмотр статьи: Google Scholar: PubMed / NCBI

22

Фекете Н, Гаделорге М, Фюрст Д., Маурер С., Даузенд Дж., Флери-Каппельессо С., Майлендер В., Лотфи Р., Игнатий А., Sensebé L и др.: Объединенный лизат тромбоцитов из цельной крови. концентраты тромбоцитов и концентраты тромбоцитов, полученные из афереза для выделения и расширения мезенхимальных клеток костного мозга человека стромальные клетки: производственный процесс, содержание и идентификация активные компоненты.Цитотерапия. 14: 540–554. 2012. Просмотр статьи: Google Scholar: PubMed / NCBI

23

Burnouf T, Strunk D, Koh MB и Schallmoser K: лизат тромбоцитов человека: замена фетальной бычьей сыворотки как золотой стандарт размножения человеческих клеток? Биоматериалы. 76: 371–387. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

24

Лыков А.П., Бондаренко Н.А., Суровцева М.А., Ким И.И., Повещенко О.В., Покушалов Е.А., Коненков В.И.: Сравнительный анализ. эффекты обогащенной тромбоцитами плазмы, лизата тромбоцитов и теленка плода сыворотка на мезенхимальных стволовых клетках.Bull Exp Biol Med. 163: 757–760. 2017. Просмотр статьи: Google Scholar: PubMed / NCBI

25

Ломанн М., Валенда Дж., Хемеда Х., Юссен С., Дрешер В., Джокенхевель С., Хатшенройтер Дж., Зенке М. и Вагнер В. Возраст донора лизата тромбоцитов человека влияет на пролиферацию и дифференцировка мезенхимальных стволовых клеток. PLoS One. 7: e378392012. Просмотр статьи: Google Scholar: PubMed / NCBI

26

Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop DJ и Horwitz E: Минимальные критерии для определения мультипотентности мезенхимальные стромальные клетки.Международное общество сотовой связи заявление о терапевтической позиции. Цитотерапия. 8: 315–317. 2006 г. Просмотр статьи: Google Scholar: PubMed / NCBI

27

Наракорнсак С, Повачиранон Н, Peerapapong L, Pothacharoen P и Aungsuchawan S: мезенхимальный стебель клетки дифференцировались в хондроцитоподобные клетки. Acta Histochem. 118: 418–429. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

28

Laowanitwattana T, Aungsuchawan S, Наракорнсак С., Маркми Р., Танчароен В., Кеоди Дж., Бунма Н., Тасуя W, Peerapapong L, Pangjaidee N и Pothacharoen P: Остеобластический потенциал дифференциации человеческих околоплодных вод мезенхимальные стволовые клетки в различных условиях культивирования.Acta Histochem. 120: 701–712. 2018. Просмотр статьи: Google Scholar: PubMed / NCBI

29

Бен Азуна Н., Дженхани Ф., Регая З., Беррейс Л., Бен Осман Т., Дюкрок Э. и Доменек Дж.: Фенотипический и функциональные характеристики мезенхимальных стволовых клеток из кости костный мозг: Сравнение культур с использованием различных сред с добавками с лизатом тромбоцитов человека или фетальной бычьей сывороткой. Стволовые клетки Res Ther. 3: 62012. Вид Статья: Google Scholar: PubMed / NCBI

30

Ким Х., Прасаин Н., Вемула С., Феркович М.Дж., Йошимото М., Войтик-Харбин С.Л. и Йодер М.С.: Лизат тромбоцитов человека улучшает выживаемость и васкулогенез ECFC, полученных из пуповинной крови в трехмерных (3D) матрицах коллагена.Microvasc Res. 101: 72–81. 2015. Просмотр статьи: Google Scholar: PubMed / NCBI

31

Джазаери М., Алламе А., Сулеймани М., Jazayeri SH, Kaviani S и Kazemnejad S: Капиллярная сеть образование эндотелиальными клетками, дифференцированными из кости человека мезенхимальные стволовые клетки костного мозга. Iran J Biotechnol. 6: 29–35. 2008.

32

Ганг ЭДжей, Чон Дж.А., Хан С., Ян Кью, Чон СиДжей и Ким Х .: Эндотелиальный потенциал ЯК человека, полученный из крови in vitro. мезенхимальные стволовые клетки.Цитотерапия. 8: 215–227. 2006. Просмотр статьи: Google Scholar: PubMed / NCBI

33

Quirici N, Soligo D, Caneva L, Servida F, Bossolasco P и Deliliers GL: дифференциация и расширение эндотелиальные клетки из CD133 (+) клеток костного мозга человека. Br J Haematol. 115: 186–194. 2001. Просмотр статьи: Google Scholar: PubMed / NCBI

34

Fortunato TM, Beltrami C, Emanueli C, De Банк PA и Pula G: гель лизата тромбоцитов и предшественники эндотелия стимулировать образование микрососудистой сети in vitro: ткань инженерные последствия.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *