Содержание

характеристики и свойства остекления, цены на стеклопакеты

Что влияет на свойства стеклопакета и сколько это стоит:

Каждый лист стекла в стеклопакете создает преграду на пути шума. Образуемая между двумя стеклами камера служит естественным теплоизолятором. При увеличении числа стекол - увеличиваются и изолирующие свойства.

Максимальное количество стекол в стеклопакете ГОСТ не нормирует. Тем не менее, у стеклопакета с большим числом стекол есть свои недостатки.

При увеличении листов стекла - увеличивается вес конструкции и снижается светопропускание окна. Цена, естественно, тоже увеличивается.

Вес стеклопакета определяется весом его стекол. Однокамерный стандартный стеклопакет (2x4 мм) весит примерно 20 кг/кв.м
Двухкамерный стандартный стеклопакет (3x4мм) весит 30 кг/кв.м. Таким образом легко высчитать вес 1 мм стекла площадью 1 кв. метр - 2,5 кг.

Двухкамерный или трехкамерный стеклопакет

Что лучше 4 стекла или 3 стекла?

Двухкамерный или однокамерный стеклопакет

Что лучше 3 стекла или 2 стекла?

Стекла тоньше 4 мм для жилищного остекления не используются в виду высокой хрупкости.

Однако чем меньше вес стеклопакета, тем меньше изнашивается фурнитура и тем исправнее прослужит окно. Подробнее в материале: Лишний вес - причина поломки окна

На что влияет толщина стекла

Чем толще стекло используется в стеклопакете, тем лучше стеклопакет изолирует от шума.

Толщина стекла Вес 1 м2 Звукоизоляция
4 мм 10 кг 28-30дБ
5 мм 12,5 29-31дБ
6 мм 15 кг 30-32дБ
8 мм 20 кг 32дБ

Звукоизоляция

Для звукоизоляции, согласно лабораторным испытаниям, подходят конструкции в изготовлении которых используется толстое листовое стекло или многослойное стекло.

Характеристика звукоизоляции стеклопакетов расчетная

     Формула Звукоизоляция
по отношению к прямому шуму воздушных судов Rw, dB
     4 мм      30
     4М1-16-4М1      30
     8 мм      32
     4М1-10-4М1-10-4М1      33
     4М1-16Ar-4М1-14Ar-И4      33
     6CGSolar-16Ar-4М1-14Ar-И4      36
     44.1М1-14-4М1      40
     44.1М1-12-66. 1М1      47

44.1 - два стекла 4 мм с ПВБ пленкой между стеклами.
66.1 - два стекла 6 мм с ПВБ пленкой между стеклами

Как видно, 8-ми миллиметровое стекло лучше изолирует от шума (32 дБ), чем однокамерный стеклопакет 4М1-16-4М1 (30 дБ).  


Подробнее: Лучшие по показателю звукоизоляции стеклопакеты

Низкоэмиссионные стекла


Низкая эмиссия - способность отражать тепловое излучение. Чем меньше коэффициент эмиссии - тем лучше материал отражает энергию, а значит является лучшим теплоизолятором.

В отечественном ГОСТ 24866-2014 применяется характеристика "Приведенное сопротивление теплопередаче"- обратная коэффициенту эмиссии. Чем выше сопротивление теплопередаче - тем лучше теплоизолирующая способность стеклопакета.

Существуют низкоэмиссионные стекла с жестким и мягким покрытиями.

  • Низкожмисионное К-стекло (стекло с жестким покрытием) может использоваться покрытием наружу, так как оно устойчиво к атмосферному воздействию и истиранию. Может быть закаленным.
  • Низкоэмисионное И-стекло (стекло с мягким покрытием) используется только покрытием внутрь пакета - оно не устойчиво к внешним воздействиям, но имеет лучшие теплоизолирующие свойства (почти в 1,5 раза).

Обозначаются стекла в стеклопакете окна: 4k и 4i соответственно, где 4 - значение толщины стекла в миллиметрах.

Мягкое низкоэмиссионное покрытие (i-стекло) используется для изготовления теплосберегающих и энергосберегающих стеклопакетов чаще.

Низкоэмиссионное стекло

Низкоэмиссионное стекло (Low Emission) со специальным теплоотражающим напылением работает по принципу термоса: изолирует от внешней среды, сохраняя температуру внутри.

Нанесенное на поверхность стекла покрытие сохраняет прозрачность и, в отличие от пленок, не может отклеиться. Само покрытие может быть нанесено :

  • на внешнее стекло (внутрь камеры) - для лучшего теплоотражения на улицу;
  • на внутреннее стекло (внутрь камеры) - для лучшего теплоотражения в помещение.


Видео: производство низкоэмиссионных стекол для стеклопакета

Теплоизоляция

Для лучшей теплоизоляции стеклопакета сегодня используются специальные теплоотражающие стекла с низкой эмиссией тепла (Low E), низкоэмиссионные, о которых мы уже упоминали. Самый распространенный вид низкоэмиссионных стекол - с мягким напылением серебра. В формуле стеклопакета обозначается буквой "И". 
Как отличить энергосберегающий стеклопакет от обычного

По ГОСТ 30674-99 стеклопакет из двух стекол, одно из которых низкоэмиссионное, - лучше стеклопакета из трех стекол по главному параметру - сопротивлению теплопередаче. Чем выше значение - тем лучше конструкция защищает от холода.

Ниже в таблице приведены характеристики теплоизоляции оконных блоков c типовым стекольным заполнением. Детально ознакомиться с теплоизоляционными свойствами стеклопакетов можно по ссылке: теплоизоляция стеклопакетов.


Формула стеклопакета Сопротивление теплопередаче
    м2 С/Вт
4М1-16-4М1      0,35 (ГОСТ)
4М1-16-И4      0,58 (ГОСТ)
4М1-16Ar-И4      0,63 (ГОСТ)
4М1-10-4М1-10-4М1      0,51 (ГОСТ)
4М1-16Ar-4М1-14Ar-И4      0,95 (расчетное)
6CGSolar-16Ar-4М1-14Ar-И4      1,45 (расчетное)

Теплосберегающий стеклопакет для теплых окон VEKA

C появлением низкоэмиссионного И-стекла теплопотери через окна существенно сократились. В быту стали употребляться выражения "теплые окна", "теплый стеклопакет", теплосберегающий стеклопакет.

Влияние стеклопакета на теплозащитные свойства окна VEKA Softline 70
Расчетные значения, согласно конфигуратору Guardian

Формула стеклопакета Сопротивление теплопередаче
    м2 С/Вт
4М1-16-4М1-14-4М1      0,59
4М1-16-4М1-14-И4      0,83
4М1-16Ar-4М1-14Ar-И4      0,97
4CGSolar-16-4М1-14-4М1      0,85
4CGSolar-16Ar-4М1-14Ar-4М1      1,00
4CGSolar-16-4М1-14-И4
     1,17
4CGSolar-16Ar-4М1-14Ar-И4      1,45

Окна с теплосберегающим стеклопакетом можно посоветовать для всех теплолюбивых хозяев.

Однако, что делать, если в жаркие дни вы ощущаете чрезмерный нагрев воздуха? Такому помещению нужны специальные стеклопакеты - стеклопакеты, способные отражать тепловую солнечную энергию наружу.

Светопропускание, защита от солнца и УФ излучения

Желание сделать окна максимально изолирующими может привести к тому, что сама прозрачность конструкции будет потеряна. 
Каждый дополнительный лист стекла в среднем на 10% ухудшает прозрачность вашего окна. Также на светопропускание влияет само стекло (низкоэмиссионное стекло хуже обычного пропускает свет, а специальное просветленное стекло - лучше обычного). 

Характеристика стекол и стеклопакетов по пропусканию света и УФ излучения, расчетная

 Формула      Пропускание света
          τv(%)
      Солярный фактор
           g (%)
      Пропускание УФ лучей
           τuv(%)
 4 мм           90           88           75
 8 мм           88           82           66
 4М1-16-4М1           83           80           60
 4М1-10-4М1-10-4М1           76           72           50
 4М1-16Ar-4М1-14Ar-И4           73           60           30
 6CGSolar-16Ar-4М1-14Ar-И4           58           38           14

При этом, как видно из таблицы, стекло триплекс 8 мм не значительно уменьшает прозрачность, в отличие от двух стекол по 4 мм в конструкции стеклопакета.

Окна с 4 стеклами по 4 мм почти на 40% лишат дом естественного освещения. 

Высокое светопропускание - важный фактор для нормальной жизнедеятельности. Тем не менее с солнечным светом в дом проникает солнечная энергия, которая способна нарушить микроклимат помещения, негативно воздействует на декоративную отделку помещения и мебели.

Солнцезащитные стекла и стеклопакеты

Солнцезащитный стеклопакет с применением напыления тонкого слоя оксида титана позволяет создать преграду на пути у тепловых солнечных волн. Снаружи такой стеклопакет обладает легким зеркальным глянцем, а изнутри прозрачен как обычное стекло.

Ключевая роль солнцезащитного стеклопакета:

  • Снижается нагрев помещения солнцем
  • Снижается выгорание мебели и интерьера

Солнцезащитные свойства стеклопакета определяет стекло с защитой от солнечной энергии, снижающее "солярный фактор".

Солярный фактор (солнечный фактор) обозначается в документации "g" и указывает процент от солнечной энергии, проходящей сквозь стеклопакет.

Чем солярный фактор ниже, тем лучшую защиту от солнца обеспечит стеклопакет. Например, солярный фактор в 40% указывает на то, что лишь 40% солнечной энергии пропускает стеклопакет.

Значение этого параметра напрямую связано с степенью защиты от ультрафиолетового излучения. Солнцезащитные стекла с низким солнечным фактором устанавливаются для помещений с произведениями искусства, чтобы избежать их выцветание от УФ излучения. В отличие от тонированных стекол, солнцезащитные стекла нового поколения прозрачны для видимого глазу света.

Энергосберегающий стеклопакет с мультифункциональным стеклом

Следующим этапом развития технологии стало совмещение в напылении сразу двух свойств: теплосбережения и солнцезащиты. Удачным решением стали так называемые мультифункциональные энергосберегающие стеклопакеты - прозрачные для света и непроницаемые для жары и холода.

Присутствие двойного напыления - титана и серебра - дает двойной эффект: экономия энергии происходит и летом и зимой:

  • Летом нет необходимости в дополнительном кондиционировании.
  • Зимой не тратятся средства на отопление.

Все свойства мультифункционального стеклопакета

Узнайте сколько стоят пластиковые окна с мультифункциональным стеклопакетом прямо сейчас используя онлайн калькулятор пластиковых окон .

Для расчета точной цены по проекту отправьте сообщение через "обратную связь" в разделе "Контакты"."

И-стекло и мультифункциональное: какое лучше, в чем отличие?

И - стекло - низкоэмиссионное стекло с высокой способностью отражать инфракрасное (тепловое) излучение.

Мультифункциональное - стекло - стекло, сочетающее в себе две функции. Первая - способность И-стекла отражать инфракрасное (тепловое) излучение. Вторая - способность солнцеотражающего стекла отражать тепловую энергии солнца.

Сравнение И-стекла (ClimaGuard N) и Мультифункционального стекла (ClimaGuard Solar)

 Формула Пропускание света
τv(%)
Солярный фактор
g (%)
Пропускание УФ лучей
τuv(%)
Сопротивление теплопередаче
м2 С/Вт
 4М1-16Ar-4М1-14Ar-И4 73 60 30 0,95 (расчетн. )
 4CGS-16Ar-4М1-14Ar-4M1 62 40 24 1,0 (расчетн.)


Вывод: мультифункциональное стекло в стеклопакете делает его не только теплосберегающим, но и лучше затеняет помещение, сохраняет его от жары.

Тонированные стекла и стеклопакеты

В остеклении домов, витрин, при устройстве офисных перегородок внутри помещений также часто используются тонированные стекла, как и в тонировке стекол автомобилей. Как правило, используется одно окрашенное в массе стекло, реже два стекла в составе одно- и двухкамерного стеклопакета. Таким образом можно достичь требуемой степени декоративного и защитного оформления.

Для каких целей используется тонированное (окрашенное) стекло в стеклопакетах:

  • Внешнее оформления остекления в соответствии с архитектурным проектом;
  • Защита от подсматривания;
  • Внутреннее затенение помещения.

Необходимое цветовое решение, помимо окрашенного в массе стекла, может быть найдено за счет поклейки тонирующей или зеркальной пленки.

Преимущества тонированного в массе стекла Преимущества пленки

Тонированный стеклопакет включает окрашенное в массе стекло. Исключено отслаивание пленки и появление пузырьков воздуха и иных визуально видимых дефектов в процессе эксплуатации.

Тонировочная пленка служит упрочняющим элементом и может использоваться для создания безопасного безосколочного остекления. Тонированный стеклопакет таким свойством не обладает.

Важным отличием тонированного стеклопакета от солнцезащитного является существенное снижение проникновения видимого света. Попадающий в помещение свет в технической документации указывается в процентах (по ГОСТ обозначается τv(%)). С тонированным стеклом светопропускание составляет до 20-30%, тогда как с солнцезащитным прозрачным стеклом в двухкамерном стеклопакете светопропускание не опускается ниже 50%.

Противоударные стеклопакеты

Для обеспечения высоких показателей по безопасности: защите от удара, разбития и пр., - применяются специальные типы стеклопакетов - противоударные.

Стойкость к удару может обеспечиваться применением одного из типов защитных стекол в составе стеклопакета:

  • Закаленное стекло - стекло с лучшей в 2-3 раза, по сравнению с обычным стеклом, стойкостью к удару;
  • Ламинированное стекло -  стекло с  противоударной пленкой, поклеенной на одну из поверхностей;
  • Армированное стекло - стекло внутри которого стальная сетка;
  • Многослойное стекло триплекс - несколько слоев листового стекла, склеенных между собой поливинилбутеральной пленкой или смолой (в первом случае речь идет о пленочном ламинировании триплекса, во втором - жидкостном).

Говоря о различиях в производстве триплекса следует учитывать следующее:

- Поскольку при изготовлении триплекса методом пленочного ламинирования одна из стадий - подогрев до температуры 80-90 градусов Цельсия, - использование низкоэмиссионных стекол в составе пленочного триплекса  не рекомендуется (нагрев может испортить покрытие). Изготовление низкоэмиссионного триплекса по технологии жидкостного ламинирования возможно.

Противоударные стеклопакеты подробнее

Особые свойства стеклопакетов

Герметично соединенные в стеклопакете стекла позволяют придать остеклению качественно новые характеристики. С практической точки зрения такая конструкция удобнее так как мыть стекла изнутри нет необходимости - они остаются чистыми в течение всего срока службы изделий, что для современных пластиковых окон составляет примерно 60 лет в умеренной климатической зоне.

Современные технологии производства стекол позволяют вводить новые типы остекления за счет использования различных декоративных, защитных и физических свойств. В частности одним из наиболее перспективных считаются разработки самоочищающихся стеклопакетов.

Самоочищающиеся стеклопакеты - стеклопакеты с гидрофобным покрытием, которое благодаря отталкивающему молекулы воды свойству сохраняет стекло чистым существенно дольше, в сравнении с обычным стеклом.

Греющие стеклопакеты или стеклопакеты с элетрообогревом стекла - стеклопакеты в которых устанавливается специальное многослойное стекло с структурированным токопроводящим слоем. При циркуляции тока по проводнику стекло способно выделять тепло до +50 0C. Подробнее.

Огнестойкие стеклопакеты - или противопожарные стеклопакеты, представляют собой конструкцию с участием многослойного стекла и огнезащитных прослоек. Такая прослойка при высоких температурах образует плотную твердую пену, защищающую от распространения пламени за счет удержания осколков стекла на месте и препятствует тепловому излучению от очага пожара.

Декоративные стеклопакеты - внутрь стеклопакета для визуального разделения на секции могут быть встроены шпросы (раскладка). Для ценителей узорного рисунка стеклопакет может быть украшен орнаментом, витражным узором в стиле витража тиффани.

Стеклопакеты с встроенными жалюзи - особенно востребованы в медицинских учреждениях, где высокие требования к гигиене из-за санитарных норм. Обычные жалюзи не подходят для оборудования ими помещений - они никак не защищены от статической пыли, в отличие от встроенных. Герметичная камера в стеклопакете служит надежным изолятором от загрязнения, тогда как управление жалюзи вынесено наружу.

Размер камеры и газ в стеклопакете

Размер камеры - расстояние между стеклами в стеклопакете - также оказывает влияние на его свойства. От того, чем заполнена эта камера - воздухом или инертным газом - также зависит теплоизоляция (см. результаты испытаний стеклопакетов с аргоном).

Принято считать что внутри стеклопакета вакуум, что в корне неверно, так как в таком случае стеклопакет просто лопнул бы сразу после выхода с конвейера под воздействием атмосферного давления.

На самом деле внутри стеклопакета обычный (осушенный) воздух или специальный инертный газ. 

На что влияет размер камеры

Улучшение звукоизоляции Нет
Улучшение теплоизоляции Да (+50%)


Улучшение теплоизоляции происходит с увеличением расстояния между стеклами - от 8 до 24 мм. Дистанция между стеклами менее 8 мм, например, 6 мм, допускается по ГОСТ 24866-2014 "Стеклопакеты клееные" только для стеклопакетов внутреннего остекления.

В двухкамерном стеклопакете увеличение дистанционной рамки более 16 мм ведет к обратному эффекту - теплоизоляция снижается.

 Формула Пропускание света
τv(%)
Солярный фактор
g (%)
Пропускание УФ лучей
τuv(%)
Сопротивление теплопередаче
м2 С/Вт
 4CGS-6Ar-4М1-6Ar-И4 59 39 15 0,88 (расчетн. )
 4CGS-16Ar-4М1-14Ar-И4 59 39 15 1,45 (расчетн.)
 4CGS-18Ar-4М1-18Ar-И4 59 39 15 1,43 (расчетн.)
 4CGS-16Ar-4М1-24Ar-И4 59 39 15 1,41 (расчетн.)

Некоторые наблюдения демонстрируют увеличение теплоизоляции при увеличении ширины камеры, но при незначительной разнице температур стекол, ограничивающих камеру. Широкая дистанция между стеклами предпочтительнее, когда эта камера - вторая в стеклопакете, то есть расположена ближе к помещению.

Для лучшей теплоизоляции эффективно заполнить камеру газом, более плотным чем воздух. В частности, повышает изоляционные свойства стеклопакета закачивание аргона. Подробнее: Зачем нужен газ в стеклопакете

Дистанционные рамки в стеклопакете

Разделяющие стекла в стеклопакете рамки выполняют одновременно несколько функций:

  • формируют теплоизоляционную воздушную камеру,
  • заполненный в рамки силикагель осушает внутрикамерный воздух,
  • декоративную - может быть выбран один из нескольких цветов.

Дистанционные рамки различаются по типу и материалу из которого изготовлены. Наиболее распространенные: пластиковые, алюминиевые, комбинированные (TGI).

Материал, например алюминий, применяемый в производстве рамки - хороший теплопроводник. Пластик - напротив, теплоизолятор. В зависимости от заказанного в производство стеклопакета, а точнее типа рамки, может возникать (или не возникать) мостик холода и запотевание. Дистанционные рамки для стеклопакета и их свойства

Как читать формулу стеклопакета

Каждый стеклопакет имеет строение, определяемое формулой. Это своеобразный паспорт изделия, по которому можно понять из каких материалов он изготовлен.

Например: 6М1-10-4М1-10Ar-И4

где, читается слева-направо:
6 - толщина внешнего стекла 6 мм;
М1 - марка стекла М1;
10 - дистанционная рамка толщиной 10 мм;
4 - толщина внутреннего стекла 4 мм;
М1 - марка стекла М1;
10 - дистанционная рамка толщиной 10 мм;
Ar - заполнение камеры инертным газом Аргон;
И - нанесение низкоэмиссионного мягкого (И) - покрытия на внутреннюю (к камере) поверхность стекла;
4 - толщина внутреннего стекла 4 мм.

При указании считается стекло крайнее левое - внешнее (уличное), крайнее правое - интерьерное (в помещение)


4М1-10Ar-4М1-10Ar-И4 — двухкамерный стеклопакет 32 мм, энергосберегающий слой есть только на внутреннем стекле + аргон в двух камерах.

Другие варианты популярных формул двухкамерных стеклопакетов:

4EnergyL-14Ar-4-14Ar-4И - мультифункциональное прозрачное стекло Energy Light + одно и-стекло + в двух камерах шириной по 14 мм газ аргон.

4PhBr-20Ar-4-20Ar-4И - феникс бронза или тонированное "в массе" стекло бронзового цвета + два аргона + и-стекло в стеклопакете толщиной 52 мм.

4STR35SISR-10ar-4-10ar-4И - это стеклопакет с серебряной тонировочной пленкой с аргоном в двух камерах и одним и-стеклом, 32мм.

4-14-4-14-4 — обычный стеклопакет толщиной 40 мм, где нет ни энергосберегающего напыления, ни заполнения аргоном.

4-10-4-10Ar-4i — один энергосберегающий слой и аргоном заполнена только внутренняя камера.

4PhCl-12ar-4-12ar-4.4.1 - бесцветное феникс-стекло (Phoenix Clear, просветлённое, обладает зеркальностью) + стекло триплекс (стратобель, многослойное стекло, повышенная ударопрочность и звукоизоляция) + аргон в двух камерах, 2-камерный стеклопакет (3 стекла), толщина стеклопакета 40мм.

Цены на стеклопакеты

Объективная цена стеклопакета определяется теми материалами, которые использовались для его производства. Чем более дорогие комплектующие - тем стоимость будет выше. Так, в частности, двухкамерный стеклопакет будет дороже однокамерного, а однокамерный с мультифункциональным стеклом и заполненный аргоном будет дороже обычного двухкамерного.

Цены на стеклопакеты за квадратный метр:

Цены на стеклопакеты


Обратитесь к специалисту оконной компании Бизнес-М за дополнительной консультацией по телефону или через обратную связь на сайте в разделе Контакты.

  

О стеклопакетах подробнее:


Выбрать пластиковые окна со стеклопакетом »

Классификация стеклопакетов. Какие они бывают? - "Окна города"

Выбор стеклопакетов нужно производить с учетом условий, в которых будут эксплуатироваться окна, чтобы, с одной стороны, получить наилучшую защиту от неблагоприятных внешних факторов: холода, уличного шума, солнечного излучения и т. п., а с другой – не переплачивать за характеристики, которые для вас не актуальны.

Итак какие же бывают стеклопакеты?

1. По количеству камер

Между каждыми двумя стеклами образуется пространство, называемое камерой. Стеклопакеты подразделяются на:

- однокамерные (2 стекла)

- двухкамерные (3 стекла)

- трехкамерные (4 стекла)

1.1.Стандарт – однокамерный стеклопакет

Самый распространенный (и самый дешевый) вариант стеклопакета – однокамерный. Например ширина стеклопакета 24 мм (4-16-4), при этом толщина одного стекла 4 мм, дистанционная рамка 16 мм, толщина второго стекла 4 мм. Установка стеклопакетов с одной камерой применяют для остекления балконов и лоджий, не отапливаемых помещений, а также, в целях экономии, на окна и балконные блоки (окно + балконная дверь), которые выходят на уже застеклённую лоджию или балкон.

Преимущества однокамерного стеклопакета:

- более легкая  конструкция по сравнению с двухкамерным, и так как меньший вес дает меньшую нагрузку на оконную фурнитуру — срок службы такого окна дольше, чем окна с двухкамерным стеклопакетом;

- высокий коэффициент светопропускания и низкий коэффициент потери тепла;

- окна с однокамерными стеклопакетами стоят дешевле двухкамерных;

- однокамерного стеклопакет  с  теплоотражающим стеклом и  заполнением его газом, при более выгодной цене по своим характеристикам аналогичен 2-х камерному.

 

1.2.Двухкамерный стеклопакет: когда нужна эффективность

Двухкамерный стеклопакет представляет из себя 3 стекла, общей шириной к примеру 32 мм (4-10-4-10-4), при этом толщина всех трех стекол по 4 мм, а дистанционная рамка между ними 10 мм. Данный вид стеклопакета является самым распространенным и оптимальным вариантом. В зависимости от условий эксплуатации окон и места расположения дома, квартиры стеклопакеты могут состоять из стекол различных характеристик: толщина, энергосбережение, цвет, ударопрочность и наличие внутренних раскладок (шпрос). По вашему желанию в одном стеклопакете всегда можно совместить высокие требования по энергосбережению, шумоизоляции, ударопрочности и дизайну.

 

2. По ширине

Ширина стеклопакета — это полная ширина блока вместе со стеклянной и воздушной частью. Встречаются стеклопакеты шириной — 14, 16, 18, 20, 22, 24, 28, 32,  36, 42, 44 мм и др.

С ростом межстекольного пространства до ~16 мм (в каждой камере) теплоизоляционные характеристики стеклопакета растут, но свыше 24 мм начинают ухудшаться, в силу роста конвективной теплопередачи в межстекольном пространстве. Для двухкамерного стеклопакета из обычного стекла с воздушным наполнением оптимальной формулой является 4-16-4-16-4 (44 мм)

Формула стеклопакета — стекло (марка)–дистанция–стекло (марка). Формула СП всегда начинается с внешнего стекла, обращённого на улицу.

Маркировка стеклопакетов:

СПО – однокамерный

СПД – двухкамерный.

Маркировка стекол:

M  — Простое оконное стекло, произведенное методом вытяжки.

F   — Стекло произведенное флоат-способом.

K  — Стекло с твердым низкоэмиссионным покрытием.

I   -  Стекло с мягким низкоэмиссионным покрытием.

S  -  Окрашенное в массе стекло

Pl  — Стекло с нанесенным на него пленочным теплоотражающим покрытием

Маркировка газов:

Воздух  Пробел по умолчанию

Ar   Аргон

Kr   Криптон

SF6  Гексафторид серы

Пример: 8M1-16-4M1-12Ar-4K: 8 мм стекло марки М1 — 16 мм возд. дистанция — 4 мм стекло М1 — 12 мм дистанция, заполнение аргон — 4 мм К-стекло.

3. По типам применяемого стекла 

  1. Энергосберегающие
  2. Мультифункциональные
  3. Шумоизоляционные
  4. Защитные (ударостойкие)
  5. Безопасные
  6. Солнцезащитные
  7. Самоочищающиеся
  8. Декоративные

3.1. Энергосберегающие стеклопакеты помимо обычного стекла, включает в себя низкоэмисионноное стекло и действует по принципу теплового зеркала.

Теплосберегающий стеклопакет снижает теплопотери более чем на 50% по отношению к обычному стеклопакету, обладает высокой светопропускной способностью и отражает ультрафиолетовое излучение.

Определить, есть ли в стеклопакете энергосберегающее стекло довольно просто. Зажгите спичку или зажигалку и поднесите ее к стеклопакету. Посмотрев под небольшим углом на отражение пламени от стекла, вы увидите четыре отражения. Если все отражения имеют один и тот же оттенок — в стеклопакете нет энергосберегающего стекла. Если одно из отражений имеет отличающийся от других оттенок, то обратите внимание на то, где оно находится. Если вторым со стороны помещения, то стеклопакет установлен правильно и энергосберегающее стекло сохранит тепло в доме.

Точно также можно проверить наличие энергосберегающего стекла и в двухкамерном стеклопакете. Только вместо четырех отражений вы увидите шесть. Если все шесть отражений будут иметь один оттенок — в стеклопакете установлены обычные стекла и данный стеклопакет не соответствует требованиям строительных норм.

 

3.2. Мультифункциональный стеклопакет (солнцезащитный и энергосберегающий). Такой стеклопакет содержит специальное стекло с многослойным напылением. По сравнению с обычным, мультифункциональный стеклопакет:

- летом отражает тепловое излучение солнца до 61% (спасает от жары), пропуская световые волны. То есть у Вас дома будет приятная прохлада и солнечный свет.

- зимой мультифункциональный стеклопакет сохраняет более 50% тепла. Тепловая энергия от источников обогрева отражается обратно в комнату. За счет эффекта «теплового зеркала» Ваши затраты на отопление уменьшаются.

 

3.3. Шумоизолирующий стеклопакет — это стеклопакет с разными по толщине стёклами. Благодаря этому окна обладают повышенными шумопоглощающими свойствами. Обычные стеклопакеты, состоят из стёкол толщиной 4 миллиметра. Шумоизоляционными может считаться уже, например, однокамерный стеклопакет из одного стекла толщиной 4 миллиметра и второго — 6 миллиметров.

«Асимметричный» стеклопакет (с разными расстояниями между стеклами) также снижает уровень шума. В подобных стеклопакетах применяют стекла триплекс, что значительно улучшает шумоизоляцию, т.к. поливинилбутираловый слой (ПВБ-слой) в составе триплекса является отличным звукопоглотителем.

Для максимального погашения звукового резонанса также необходимо обеспечить герметичность стыков и плотный прижим створок.

Насколько эффективно шумоизоляционный стеклопакет справляется с уличным шумом?

Норма зашумленности помещения по ГОСТу не должна превышать 40-45 ДБ.

Для наглядности, сравним: уровень звукового давления на тихой городской улице — 40 ДБ, улице со средним движением — 60 ДБ, с интенсивным движением — 80 ДБ.

Шумоизоляционные окна снижают уровень шума на 30-40 Дб

 

3.4 Защитный (ударостойкий) стеклопакет

При изготовлении ударостойких стеклопакетов применяется ламинированное стекло «триплекс». Триплекс (от лат. triplex — тройной) — многослойное стекло (два или более органических или силикатных стекла, склеенные между собой специальной полимерной плёнкой или фотоотверждаемой композицией, способной при ударе удерживать осколки). Представляет собой многослойный блок, обладающий защитными свойствами. Эти стекла обеспечивают защиту помещений при проникновении на объекты с использованием молотка, топора и др. Принимаются под охрану как пассивное средство защиты, альтернатива решеткам.

При разрушении стекла, осколки не разлетаются, а остаются на склеивающем слое. Поврежденный триплекс не требует незамедлительной замены и продолжает функционировать даже при серьезных ветровых и ливневых нагрузках. Пленка защищает людей от осколков при несчастных случаях, взрывах, стихийных бедствиях.

Область применения таких стеклопакетов/стекол достаточно обширна: автомобильные стекла в обязательном порядке покрыты защитной пленкой; стеклянные крыши зимних садов; стеклопакеты в окнах небоскребов; большие по площади витрины,  входные группы в общественных помещениях с большой проходимостью и т. д.

 

3.5  Безопасный (безосколочный) стеклопакет 

Для изготовления безопасного стеклопакета используется закаленное стекло, которое в 4-5 раз прочнее обычного.

Закаленное стекло – этот тип стекол подвергается специальной термической обработке, или, проще говоря, закалке. В результате этого процесса возникают внутренние распределенные напряжения, благодаря чему значительно увеличивается механическая прочность покрытия, увеличиваются ударопрочные функции и достигается безопасный характер разрушения.

Закаленное стекло прочнее классического в 5-7 раз. При повреждении целостности оно распадается на множество мелких осколков с притупленными краями, а обычные стекла распадаются на осколки с длинными и острыми клиновидными кромками, которые могут нанести значительный вред здоровью человека.

Качество закаленного стекла в России строго регламентировано ГОСТом:

Стекло при разрушении не должно образовывать крупные (более 3 см2) осколки. Осколки не должны иметь заостренных концов; угол, образованный двумя смежными сторонами, не должен быть менее 45 градусов, при этом длина осколков не должна превышать 75 мм, а число осколков длиной от 60 до 75 мм не должно превышать пяти. (ГОСТ 30698-2000 «Стекло закаленное строительное: Технические условия»).

 3.6. Солнцезащитный стеклопакеты

В этом стеклопакете используется тонированное стекло, которое обладает всеми обычными свойствами стекла за исключением светопроницаемости. Как правило, тонированные стеклопакеты используют в помещениях с солнечной стороны либо в декоративных целях.

СП солнцезащитные могут быть изготовлены с использованием:

  • Стекол, окрашенных в массе;
  • Стекла с нанесением оксидно-металлического покрытия (рефлективные стекла) с зеркальным отражением различной цветовой гаммы;
  • Стекол с тонирующей пленкой.

Окрашенные в массе стекла могут быть серого, голубого, зеленого и бронзового цвета.

Применение солнцезащитных стеклопакетов не только обеспечивает эффективную солнцезащиту помещений и снизит утомляемость от воздействия солнечного фактора, но и придаст помещению и зданию оригинальный архитектурно-художественный облик.

 

3.7.Самоочищающиеся

Самоочищающиеся стекла для металлопластиковых окон — новинка. Pilkington Activ– это обычное стекло со специальным покрытием на внешней поверхности, обладающим двойным действием. При попадании на стекло дневного света его покрытие сначала разрушает любые органические загрязнения, а потом дождевая вода, равномерно стекая вниз, смывает грязь со стекла.

Покрытие не влияет на прочностные характеристики стекла, и только снижает светопропускание на 5-6% по сравнению с обычным прозрачным стеклом. Под некоторыми углами стекло имеет несколько больший, чем обычное стекло, зеркальный эффект с небольшим синеватым оттенком, что придает ему более чистый и привлекательный вид. Покрытие имеет хорошую устойчивость к царапинам и длительный срок службы, и в большинстве случаев, с ним можно обращаться как с обычным флоат-стеклом.

 

3.8. Декоративные стеклопакеты.

Нельзя говорить о стеклопакетах и обойти вниманием декоративные раскладки. Применение декоративных раскладок придает окнам эксклюзивность, фасаду здания индивидуальный облик, подчеркивает достоинства архитектурного замысла.

Различают два вида раскладок: внешнюю и внутреннюю.

Внутренняя декоративная раскладка в стеклопакете (шпроссы) — это декоративный профиль, размещенный внутри стеклопакета. Изготавливают раскладки из алюминиевого профиля различной ширины (8-18-24-26-40 мм) и окрашиваются в широкую цветовую гамму. Шпроссы находятся внутри стеклопакета и абсолютно не мешают мыть окна.

Внешняя декоративная раскладка (фальш-переплет) наклеивается с наружной стороны стеклопакета или зеркально с двух сторон. Обычно выбирается в цвет профиля. Фальш-переплет имитирует разделение створки/окна на части. Изготавливается из ПВХ-профиля и приклеивается при монтаже окон.

 

Тепловые характеристики окон

Тепло из помещения уходит через стены (~ 30 %), кровлю (~ 14%), пол (~ 12 %) и окна (~ 44%). А 80% тепла, проходящего через окно, «утекает» именно через стеклопакет.

Хорошая теплоизоляция – основное требование, которое предъявляется к современным оконным конструкциям, поскольку именно она обеспечивает комфортные условия внутри помещения. Однако не все окна одинаково хорошо сохраняют тепло.

Тепловые характеристики окон можно достаточно точно рассчитать. В России для оценки теплозащитных характеристик конструкций принят коэффициент сопротивления теплопередаче Ro.

Приведем пример расчета коэффициента Ro для стандартного окна размером 1300х1400 мм.

Доля площади пластиковой системы (профиля) в окне примерно 25-30%, доля площади стеклопакета порядка 70-75%. Таким образом, коэффициент сопротивление теплопередаче Ro окна будет рассчитываться по формуле:

Исходя из значений коэффициента Ro, рассчитанных производителями профильных систем и стекла, получаем значения коэффициентов Ro для окна в целом.

  КБЕ Энджин
58 мм
КБЕ Эксперт
70 мм
TROCAL Balance
70 мм
КБЕ
88 мм
  Ro 0,62 0,76 0,84 1,07
1 камерный стеклопакет 24 мм 0,32 0,22 + 0,19 = 0,41 0,22 +0,23 = 0,45 0,22 + 0,25 = 0,47 0,22 + 0,32 = 0,54
2 камерный стеклопакет 32 мм 0,47 0,33 +0,19 = 0,52 0,33 +0,23 = 0,56 0,33 + 0,25 = 0,58 0,33 + 0,32 = 0,65
2 камерный стеклопакет 38 мм 0,49 0,34 +0,19 = 0,53 0,34 +0,23 = 0,57 0,34 + 0,25 = 0,59 0,34 + 0,32 = 0,66
2 камерный стеклопакет 42 мм 0,51 0,36 +0,19 = 0,55 0,36 +0,23 = 0,59 0,36 + 0,25 = 0,61 0,36 + 0,32 = 0,68
1 камерный стеклопакет 24 мм +Э 0,59 0,41 +0,19 = 0,60 0,41 + 0,23 = 0,64 0,41 + 0,25 = 0,66 0,41 + 0,32 = 0,73
2 камерный стеклопакет 32 мм + Э 0,64 0,45 + 0,19 = 0,65 0,45 +0,23 = 0,68 0,45 + 0,25 = 0,70 0,45 + 0,32 = 0,77
2 камерный стеклопакет 38 мм + Э 0,68 0,48 +0,19 = 0,67 0,48 + 0,23 = 0,71 0,48 + 0,25 = 0,73 0,48 + 0,32 = 0,80
2 камерный стеклопакет 42 мм + Э 0,71 0,50 +0,19 = 0,69 0,50 +0,23 = 0,73 0,50 + 0,25 = 0,75 0,50 + 0,32 = 0,82
+ Э – стеклопакет с энергосберегающим или мультифункциональным стеклом.

Чем больше показатель Ro, тем меньше теплопередача через конструкцию, а значит, меньшее количество тепла теряется через такое окно. Из таблицы, к примеру, видно, что окно, сделанное из профильной системы КБЕ Энджин с монтажной шириной 58 мм, с однокамерным стеклопакетом имеет коэффициент Ro, равный 0,41. Конструкция такого же размера и той же конфигурации, но выполненная из профиля КБЕ 88 мм, с 2-х камерным энергосберегающим стеклопакетом имеет коэффициент Ro = 0,82. Эти цифры означают, что последнее окно отдает тепла в 2 раза меньше, чем первое.

Требуемые значения величины Ro для каждого региона нашей страны различны и определяются в соответствии с продолжительностью отопительного периода.

Таким образом, толщина и геометрия профильной системы, а также количество камер и наличие специальных энергосберегающих покрытий на стекле напрямую влияют на то, насколько эффективно окно сохраняет тепло в доме.

Для достижения максимальных показателей по энергосбережению завод «ROMAX» рекомендует сочетать в двухкамерном стеклопакете мультифункциональное и энергосберегающее стекло, а также заполнять стеклопакет инертным газом аргоном.

Трехкамерный стеклопакет все за и против. Мнение оконных экспертов

Все чаще и чаще на украинском оконном рынке мы стали встречать такое понятие как «трехкамерный стеклопакет». Это отнюдь не новинка, и технология была представлена уже достаточно давно. Но пока популярности она на украинском оконном рынке не набрала. Но при этом, сложно оспорить более высокую энергоэффективность данного продукта, а именно это нам сейчас и необходимо. Так стоит ли игра свеч? В этой статье мы попытаемся собрать максимальную информацию об этом продукте и услышать мнение профильных экспертов украинского оконного рынка и переработчиков.

 

Наряду с широко распространенными однокамерными и двухкамерными стеклопакетами существует еще одна конструкция стеклопакета – трехкамерный.
Это самая толстая и массивная стеклоконструкция с заявленными наилучшими энергосберегающими и шумоизолирующими характеристиками и одновременно с рядом недостатков, которые ограничивают возможности ее употребления.
На рынке оконных изделий эта продукция появилась позже других стеклопакетов и занимает относительно небольшой его сегмент.

Что такое трехкамерный стеклопакет?

Как и любой стеклопакет, трехкамерный представляет собой замкнутую стеклянную конструкцию из разделенных дистанционными рамками стекол одинаковой или различной толщины, и образовавшихся между этими стеклами герметичных воздушных камер – заполненных специальным воздушным или газовым составом промежутков.
В трехкамерном стеклопакете таких камер 3 (стекол – 4) и это максимум на сегодняшний день и в перспективе. Если применительно к ПВХ окнам говорят про 4, 5, 7 камер, речь идет о камерах не стеклопакета, а профиля.
Основные показания к выбору трехкамерного стеклопакета:
•    суровые климатические условия, повышенные требования к теплоизоляции;
•    проживание в зоне повышенного шума и необходимость надежной защиты от него.
Дополнительная камера: за и против
Во второй климатической зоне Украины такие стеклопакеты не особо востребованы, используются редко, их серийное производство не налажено. Информации о результатах испытаний таких стеклопакетов с конкретными цифрами практически нет, но некоторые их характеристики неоспоримы.
По разным данным, при сравнении сопротивления теплопередаче стеклопакетов с различным числом камер цифры показывают, что каждая дополнительная камера увеличивает этот коэффициент примерно в полтора раза.
То есть трехкамерный стеклопакет однозначно теплее, для него этот коэффициент составляет минимум 0,65 м.кв.*⁰С/Вт, а при увеличении толщины стекол, ширины камер, установке энергосберегающих стекол с заполнением инертным газом может приближаться к единице (0,96).
Следует учитывать, что рациональнее повышать теплосберегающие характеристики стеклопакета за счет установки низкоэмиссионных стекол и заполнения, а не за счет увеличения числа камер при использовании обычных стекол с воздушным заполнением.
Шумопоглощающие характеристики стеклопакетов также прямо пропорциональны числу камер. Но, по отзывам немногочисленных пользователей окон с трехкамерными стеклопакетами, они лучше задерживают высокочастотные шумы, а шум поезда все же пропускают.

Трехкамерные стеклопакеты значительно хуже пропускают свет, поэтому хороши для Заполярья, где климат суровый, а уровень естественного освещения все равно низкий, так что связанный с низкой светопропускной способностью таких окон дискомфорт практически неощутим.

Если цена двухкамерных и однокамерных стеклопакетов отличается не слишком разительно, то трехкамерные ощутимо дороже (в сравнении с двухкамерными – порядка 35%-50%). Это связано не столько с увеличенным расходом материалов, сколько с усложнением технологии, применением эксклюзивного оборудования, малосерийным производством – штучный товар всегда дороже.
Такой стеклопакет требует усиленного профиля, максимально прочной фурнитуры, возрастают расходы на транспортировку, усложняется технология остекления, возрастают требования к квалификации монтажников.
Трехкамерные стеклопакеты предпочтительней для глухого остекления, нагрузка на открывающуюся створку и фурнитуру слишком высока.
Приходится использовать частый оконный переплет для повышения жесткости конструкции, а это уменьшение светового проема окна, которое через 4 стекла и так мало света пропускает. Словом, выбор трехкамерного стеклопакета приведет к существенным хлопотам и затратам.

Окна с тройным остеклением

Часто смешивают понятия «трехкамерный стеклопакет» и «тройное остекление». Тройным называется остекление, при котором используются 3 стекла, а в трехкамерном пакете их 4. Есть несколько возможностей тройного остекления окна:
•    Установить двухкамерный стеклопакет из трех стекол – самый распространенный, простой и рациональный вариант с оптимальной ценой.
•    Установить однокамерный стеклопакет (2 стекла) плюс одинарное стекло. В этом случае нужна особая двухрамная конструкция, где во внутреннюю раму (профиль) устанавливается стеклопакет, а в наружную – одинарное стекло. Данная технология применяется преимущественно в деревянных и деревоалюминиевых окнах.

Сколько стекол в трехкамерном стеклопакете

Камера стеклопакета – это промежуток между двумя стеклами, так что в стеклопакете стекол всегда на 1 больше, чем камер. В тройном (трехслойном) стеклопакете 3 стекла и 2 камеры. А в трехкамерном 4 стекла, 3 дистанционных рамки и 3 камеры. Чаще всего используются следующие формулы трехкамерных стеклопакетов:
•    4-20-1,6-20-1,6-20-4 (в разработке)
•    4-8-4-8-4-8-4
•    3-12-3-12-3-12-3 (редкий в применении)

   
   
 

Как выглядит трехкамерный стеклопакет

В разрезе трехкамерный стеклопакет – это конструкция из четырех стекол, разделенных распорными рамками и воздушными промежутками. Со стороны количества стекол не видно, конструкция воспринимается как монолит, но внутри можно увидеть проходящие по всему периметру три ряда разделительных рамок. Снаружи по контуру стеклопакет покрыт герметиком.
Визуально трехкамерный стеклопакет отличается от одно- и двухкамерных большей толщиной, а вот площадь его обычно значительно меньше, при увеличении размеров он приобретает существенное увеличение в весе, при использовании стандартных 4 мм стекол. Но сегодня уже встречаются стеклопакеты с толщиной внутренних стекол до 1,6 мм, вес такого стеклопакета не очень отличается от простого двухкамерного, но стоимость этого решения пока достаточно высока.

Толщина трехкамерного стеклопакета

Толщина любого стеклопакета равна сумме всех межстекольных расстояний и толщине всех стекол.
С учетом того, что минимально допустимое расстояние между стеклами 6 мм, а используют в стеклопакетах преимущественно стекла 4-х миллиметровой толщины, можно определить, что минимальная толщина трехкамерного стеклопакета может составлять 34 мм (3х6+4х4).
Но увеличение числа стекол при минимальной ширине воздушных камер не оправдано, так что на практике выпускаются стеклопакеты толщиной от 40 мм.
При симметричной конструкции это 4 стандартных (4 мм) стекла и 3 камеры по 8 мм шириной. 40 мм – ходовая толщина двухкамерных стеклопакетов, так что стеклопакет (4-8-4-8-4-8-4) вполне можно установить в профиль вместо двухкамерного (4-14-4-14-4), при условии, что профиль выдержит нагрузку по весу.
При использовании стандартных стекол и оптимальной ширине воздушных камер (16 мм) толщина стеклопакета может достигать 4х4+16х3=64 мм, а при использовании стекол большей толщины – и превышать это значение. Но, опять-таки, теоретически.
Нужно учитывать, что стеклопакет устанавливается в профиль, а у него своя монтажная ширина и предельно допустимое значение толщины устанавливаемого стеклопакета:
•    Стеклопакет толщиной до 42 мм можно установить в профиль КВЕ Селект 70мм, Rehau Brilliant Design или Delight-Design, VEKA PROLINE, SWINGLINE.
•    44 мм — Rehau INTELIO.
•    48 мм — Salamander 3D и Designe Streamline, Corona SI 82 от Schuco.
•    50 мм — Alphaline 90 от VEKA, Roplasto Granto.
•    52 мм — REHAU Geneo, VEKA Softline 82.
•    56 мм — Eforte от Deceuninck.
•    60 мм — Salamander BluEvolution, это максимально возможная ширина стеклопакетов.

Трехкамерная конструкция предоставляет широкие возможности для комбинации стекол разной толщины и сочетания разной ширины камер. Так, компания «Солнечные окна» (производитель конструкций завод «Канталь») предлагает окна серии LUX energeto® VS с трехкамерными стеклопакетами (производитель стеклопакетов компания GlasTrösch) толщиной 48 мм, наружная камера имеет 10 мм, а толщина внешнего стекла 4 мм.
А, например, разработчик инновационных стеклопакетов компания DRUTEX SA предлагает симметричные трехкамерные стеклопакеты толщиной 48 мм, с уменьшенной толщиной стекол (4 стекла по 3 мм и 3 камеры по 12 мм). В них используется 2-3 низкоэмиссионных стекла с покрытием нового поколения и криптоновое заполнение (газ, превосходящий аргон теплоизоляционными характеристиками). Это дорогое, но более удобное в монтаже и энергоэффективное решение.

Компания Lisec, производитель оборудования для обработки стекла, поддержала проект MEM4WIN по созданию энергоэффективного окна с трехкамерным стеклопакетом из ультратонкого стекла для массового производства. Что характерно, в инновационной конструкции предлагается применить тот же тип стекла, который используется в смартфонах.
Окна являются частью здания, которая существенно влияет на потребление энергии. Именно поэтому Европейская Комиссия поддерживает исследования по современным решениям с использованием различных инструментов. Одним из них является 7-ая рамочная программа по научным исследованиям и технологическому развитию FR7 (Seventh Framework Programme for Research and Technological Development), с помощью которой возникло и финансируется несколько исследовательских групп.
Члены одной из них, MEM4WIN (Membranes for Windows - Мембраны для окон), работают над созданием окна с инновационным трёхкамерным стеклопакетом. При этом оно должно обладать очень высокой теплоизоляцией и быть продуктом массового производства.
Работающий в этой группе Франц Фельдмейер (Franz Feldmeier) считает, что добавление четвертого стекла может способствовать достижению коэффициента теплопередачи на уровне 0,35 Вт/м2К. При использовании стеклянных панелей толщиной 4 мм с 20-миллиметровыми камерами между ними светопропускание будет составлять 65%, коэффициент пропускания энергии солнечного излучения – 46%, а вес стеклопакета – 40 кг/м².
При стандартном подходе возникает ряд проблем. Первой из них может стать большая разница температур между наружной и внутренней стороной в зимний период, что может привести  к стрессу материала. Поэтому стекла должны быть закаленными. Кроме того, на данный момент есть мало типов оконных рам, которые бы выдержали столь тяжелое остекление. Таким образом, команда MEM4WIN поставила цель создать такой трехкамерный стеклопакет, в котором листы стекла имеют толщину всего 1,6 мм, что позволит снизить нагрузку на рамы и фурнитуру.
Окно будущего включает в себя трехкамерный стеклопакет на основе ультратонкого стекла в сочетании с системой затенения и управления светом, изготовленного из микрозеркал (так называемые активные окна). Ультратонкое стекло в данном случае означает термически предварительно обработанные листы стекла толщиной 1,6 мм – тот же тип стекла, который используется в смартфонах. В отличие от 4 мм флоат-стекла, это очень легкий материал – весит всего 15 кг / м² – в то же время отличается прочностью, высокой эластичностью и требует очень мало ресурсов. Кроме того, производственные затраты будут на 15% ниже, а выбросы CO2 на 45% меньше, чем в случае с аналогичными конструкциями с энергосберегающим стеклом. Также цель разработчиков состоит в том, чтобы достичь значения Ug=0,3 Вт / (м² К).
Конструкция стеклопакета предусматривает сегменты с использованием органических солнечных батарей, солнечной тепловой установки и органических светодиодов (OLED). У инновационного окна открывающаяся створка не будет иметь раму, а фурнитура створки будет интегрирована в уплотнения.
Как сообщает источник, результаты изысканий команды MEM4WIN, во главе которой стоит компания Lisec и Университет Касселя, должны стать достоянием гласности в ближайшее время.

Трехкамерный стеклопакет – конструкция, на сегодняшний день не получившая широкого распространения из-за сложности производства, дороговизны, солидного веса, вызывающего ряд проблем при подборе комплектующих и монтаже.
Но для наиболее холодных температурных зон трехкамерный стеклопакет является лучшим решением, особенно при использовании энергосберегающих технологий. А вот в наших украинских климатических зонах установка таких стеклопакетов дело вкуса и кошелька клиента.

Для получения дополнительных аргументов мы обратились к нашим украинским экспертам в этой области, со следующими вопросами:
•    Насколько есть необходимость и рациональность в производстве и установке трехкамерных стеклопакетов. Ваше личное мнение?
•    Все «за» и «против» трехкамерного стеклопакета.
•    Какие есть технические особенности, нюансы производства и установки, а также зоны и места применения таких продуктов?
•    Как повлияет установка такого стеклопакета на стоимость конечного изделия?
•    Выводы.

 

      

Сергей Сорокун
Коммерческий директор
группы предприятий
Глас Трёш в Украине
и Молдове

 

1. Трехкамерный стеклопакет – это новый и малоиспользуемый в массовом производстве продукт. Наши европейские коллеги очень редко получают заказы на изготовление трехкамерных стеклопакетов, так как достичь установленных в Европе нормативных показателей вполне возможно применяя двухкамерный стеклопакет с двумя энергосберегающими стеклами и аргоновым либо криптоновым заполнением межстекольного пространства. В данном случае опереться на опыт наших европейских коллег не представляется возможным. Все предприятия группы Глас Трёш в Украине имеют техническую возможность изготовления трехкамерных стеклопакетов. Как и в Европе, доля таких заказов еще очень и очень низкая. Достичь нормативных показателей в Украине также вполне возможно применяя двухкамерный стеклопакет с одним низкоэмиссионным стеклом и аргоном. Улучшить энергоэффективные показатели можно, применив два низкоэмиссионных стекла с двумя слоями серебра (Энергопакет Zero) с заполнением межстекольного пространства инертным газом криптоном. По моему мнению, применение трехкамерного стеклопакета будет рациональным и эффективным в сочетании с двумя низкоэмиссионными стеклами, криптоном и просветленными внутренними стеклами с притупленными кромками, а также с теплыми дистанционными рамками.       
2. Все «за» и «против» трехкамерного стеклопакета.
«За»: повышенная тепло- и звукоизоляция только с применением криптона.  
«Против»: большой вес стеклопакета – сложность монтажа, повышенная нагрузка на фурнитуру. Низкий уровень пропускания видимого света – низкая природная освещенность жилых помещений с применением непросветленных стекол.
 3. Дополнительная камера и четвертое стекло не несет никой дополнительной технической сложности для наших предприятий группы Glas Trösch в изготовлении трехкамерного стеклопакета. Мы ограничены только максимальной толщиной (монтажной глубиной) стеклопакета, которая составляет 64 мм. Сложность установки – это большой вес стеклопакета (минимум +10 кг/м2 к весу двухкамерного стеклопакета). Применять трехкамерные стеклопакеты рациональней всего в глухом остеклении от пола до потолка на северной стороне с применением криптона и внутренних просветленных, шлифованных стекол или в инновационных профильных дерево- и ПВХ системах, имеющих коэффициент сопротивления теплопередаче R выше 1. 0 м2 K/Вт.  
 4. Применение дополнительных материалов в структуре стеклопакета приведет, естественно к удорожанию, трехкамерного стеклопакета по сравнению с двухкамерным минимум на 30%, а с применением материалов для достижения максимального результата, удорожание составит минимум 50%.
 5. Применяя трехкамерный стеклопакет необходимо подойти очень серьезно к предварительному расчету всех технических характеристик конечной конструкции. Проверить теплофизические показатели, необходимый уровень звукоизоляции, уровень пропускания видимого света, ультрафиолета, предусмотреть необходимый уровень пассивной и активной безопасности, статические и динамические нагрузки несущей конструкции, ветровые нагрузки и т.д. И только лишь после того, как выяснится, что двухкамерный стеклопакет не справится с установленными требованиями, применение трехкамерного стеклопакета в правильной комплектации будет оправдано.   

 

     
Максим Фролов
Территориальный менеджер
Guardian Industries
 

1. Для чего человек меняет окно? Чтобы стало тише, чтобы дом смотрелся красиво и, в первую очередь, чтобы сохранить тепло в помещении. Современные энергоэффективные стекла изменили привычное представление об окне. Стекло может защищать дом от теплопотерь. Вопрос в степени этой защиты. Одно энергоэффективное стекло – больше тепла остается в помещении. Два (в двухкамерном стеклопакете) – и у вас по-настоящему теплое окно. Трехкамерный пакет (4 стекла) имеет смысл ставить, если в нем установить два или даже три энергостекла. Данные стеклопакеты уже не первую выставку показывают как нововведение. Такое окно позволяет добиться потрясающих результатов по энергосбережению до U-value = 0,3 W/m2K. Вопрос рациональности установки таких пакетов следует задать и коллегам. Какая будет фурнитура (стеклопакет становится тяжелее, нагрузки выше), легко ли подобрать профильную систему, найдутся ли опытные установщики и пр.
Наш технический отдел провел все необходимые расчеты в соответствии с ДБН В 2. 6-31.2006, они представлены в таблице.

2. Все «за» и «против» трехкамерного стеклопакета.
«За»
•    Увеличение сопротивления теплопередачи центральной зоны стеклопакета до 44%.
•    Увеличение шумоизоляции.
•    Снижение вероятности выпадения конденсата.
«Против»
•    Отсутствие\недостаток опыта эксплуатации. Допускаю, что могут возникнуть проблемы с разрушением стекол от климатических нагрузок при определенном стечении обстоятельств.
•    Ограничение размеров стеклопакетов.
•    Высокая стоимость.
•    Не рекомендуется установка энергосберегающих стекол средними стеклами по причине высокого риска термошока.
•    Требует специфическую профильную систему (более дорогую).
•    Увеличение веса изделия на 10 кг или на 33% на 1 кв.м по сравнению с двухкамерным стеклопакетом.
•    Снижение прозрачности стеклопакета на 12% по сравнению с двухкамерным стеклопакетом i+i.
4. Очевидно, что такой стеклопакет (СПТ) потребует более дорогую профильную систему, способную вместить стеклопакет хотя бы толщиной 46-52 мм. А это влияет на увеличение стоимости окна.  Также сам СПТ по факту - штучное изделие, которое будет стоить дороже стандартных решений. Экономическая целесообразность покупки окна с СПТ i+i остается под вопросом.

      
Сергей Хмеленко
Коммерческий директор
компании «Сонячні вікна»
 

На наш взгляд, трехкамерный стеклопакет – это следующий шаг в развитии оконных технологий. Говорить о необходимости и рациональности применения трехкамерных стеклопакетов не совсем корректно – правильно говорить об инновациях. Трехкамерный стеклопакет – это абсолютно инновационный продукт, который позволяет достичь Ug =  0,4 Вт/ m2K.
Применение трехкамерного стеклопакета дает возможность создавать оконные конструкции нового поколения с максимальным коэффициентом теплопроводности. Uw может достигать 0,79 Вт/m2K и ниже. В то же время при создании оконных конструкций необходимо учитывать ряд особенностей трехкамерного стеклопакета: его вес и толщину. Из-за достаточно большого веса такой стеклопакет лучше использовать в системах с вклеенным стеклопакетом. Большая ширина стеклопакета не дает возможности использовать его в системах, с монтажной шириной менее чем 82 мм. Исходя из выше сказанного, можно сделать вывод, что энергоэффективные окна с трехкамерным стеклопакетом имеют достаточно высокую стоимость, но позволяют достигать максимальных значений коэффициента теплопроводности.
Применение  оконных конструкций с трехкамерным стеклопакетом целесообразно при строительстве пассивных домов и домов с минимальным потреблением тепловой энергии, что на сегодняшний день очень актуально для нашей страны.
Примером энергоэффективной инновационной системы с трехкамерным стеклопакетом является система Lux energeto VS. В этой системе реализовано множество инноваций, таких как:
•    Трехкамерный стеклопакет.
•    Наружное и внутреннее стекло – Silver Star Zero.
•    Камеры стеклопакета заполнены криптоном.
•    «Теплая» дистанционная рамка в стеклопакете.
•    Вклеенный стеклопакет в створку с помощью технологии BONDING INSIDE.
•    Отсутствие металлического усилителя в створке благодаря использованию технологии POWERDUR INSIDE.
В заключение можно сказать, что металлопластиковые окна с трехкамерным стеклопакетом – это следующий шаг в развитии оконных технологий.

 

      
Алексей Бубнов
Директор Ассоциации
«Участников рынка
окон и фасадов»
 

Безусловно, пока, кроме вакуумных стеклопакетов, и систем со спаренным оконным переплетом, альтернатив трехкамерному стеклопакету не много. К сожалению, это еще не все, из перечисленных минусов трехкамерных стеклопакетов, но опасаться этих минусов не стоит если доверить изготовление профессионалам.
Кроме этого, трехкамерные стеклопакеты должно применяться в комплексе с другими мероприятиями по энергоэффективности, в первую очередь с такими, как вентиляция и монтаж. В противном случае, вся достигнутая экономия «вылетит в трубу». И здесь мы имеем дело с комплексной оценкой энергопотерь, при проектировании здания, как в зимнее так и в летнее время года и эффективности конкретных проектных решений.
Что касается увеличения веса створок отрывающихся элементов, то здесь проблем больших нет, если только окно не изготовлено из облегченных профилей а-ля «папье маше». Современная оконная фурнитура и технология вклейки стеклопакетов легко справляется с увеличением веса конструкции. В некоторых случаях, если решен вопрос с вентиляцией (поддержанием комфортного температурно-влажностного режима) помещения и мойкой (обслуживанием) окна снаружи, то такие конструкции можно делать без открывающихся элементов.
В любом случае, доверять такую работу можно только высокопрофессиональным и проверенным фирмам.
                
                      

Окна Rehau Intelio 80 мм

Новинка от Rehau, не имеющая аналогов в своем классе по звукоизоляции, теплотехнике, воздухопроницаемости, водонепроницаемости и защите от взлома. Оконная система Rehau Intelio объединила в себе все преимущества инновационных решений компании.

Intelio — новейшая разработка Rehau, которая представляет собой многокамерную систему с оптимальной высотой комбинаций главных профилей, что обеспечивает сочетание высоких теплоизоляционных свойств с максимальным светопропусканием. Глубина фальца остекления увеличена до 66 мм, именно это и позволяет устанавливать 2-ух камерные стеклопакеты глубиной 44 мм с использованием штапика 14,5 мм.

Это решение не только максимально теплое, благодаря ему стало возможным применение специальных стекол, обеспечивающих исключительную звукоизоляцию (не менее 36 дБ(А)). В результате уровень шума внутри помещения снижается вдвое, что делает Rehau Intelio самыми «тихими» окнами из существующих на сегодняшний день. Система Intelio способна создать современной семье комфортную среду для отдыха, работы и учебы.

Преимущества профиля Rehau Intelio 80

Толщина профиля, мм

80

Количество камер

6

Теплоизоляция

0,98 м2°С/Вт.

Толщина стеклопакета, мм

42/50

Цвет профиля в массе
либо покраска по шкале RAL
Ламинация профиля

Возможна в цвета по RENOLIT

Цвет уплотнительной резины
Штапик
при однокамерном
стеклопакете 42 мм:
скошенный закругленный фигурный
Штапик
при двухкамерном
стеклопакете 50 мм:
скошенный

Преимущества профиля Rehau Intelio:

  • Наличие створок с ограничителем конвекции;
  • Наличие двух контуров свариваемых уплотнений;
  • Новый вид уплотнений для максимальной герметичности;
  • Защита от взлома: до 3 класса;
  • Звукоизоляция: до 4 класса.

Умный комфорт

Выполненные в двух вариантах дизайна створки (со скругленным и с традиционным — скошенным наплавом со стороны улицы) оснащены ограничителями конвекции. Ограничитель конвекции — ещё одно инновационное техническое решение от Rehau. Это приэкструдированный в фальце остекления створки дополнительный лепесток уплотнения, после установки заполнения (стеклопакета, либо непрозрачной сэндвич-панели) разделяющий воздушное пространство вокруг него на 2 автономно работающие предкамеры и таким образом способствующий снижению потерь тепла в результате уменьшения конвекции воздуха в пространстве фальца остекления.

В оконной системе Rehau Intelio предусмотрены два контура свариваемых уплотнений, материал и форма которых отлично зарекомендовали себя в инновационной системе Rehau GENEO® .

Новый вид уплотнений позволяет обеспечить максимальную герметичность оконных и балконных дверных блоков из профилей Rehau Intelio, при этом открываются и закрываются они при минимальном усилии.

Армирование системы Intelio типоразмера 35×28 мм, стандартное для большинства систем Rehau, позволяет экономить место на складе комплектующих и оптимизировать раскрой армирования. В программе поставок представлен полный комплект дополнительных профилей. Белые профили стандартно оснащаются свариваемыми уплотнениями серого цвета, кашированные — черного, в качестве ремонтных предлагается использовать уплотнения из TPE или EPDM.

Возможности

Оконные и балконные двери с использованием профильных систем Rehau Intelio не требуют специальных приспособлений при производстве. Задача системы Rehau Intelio заключается в том, чтобы создать максимально комфортные условия для отдыха, работы или учебы в помещениях любого назначения.

Комплектующие для окон

Рассчитаем пластиковые окна за 5 минут

Виды стеклопакетов для пластиковых окон и как их выбрать

Содержание статьи

Стеклопакеты занимают около 80% площади оконного проема. Поэтому ключевые характеристики ПВХ конструкций зависят не только от пластикового профиля и уплотнителя, но и от заполнения. Используя различные виды обработки, материалы и способы сборки, на производстве стеклопакетам придают особенные свойства. Это могут быть ударопрочность, теплосбережение, шумоизоляция, декоративность и другие характеристики.

Чтобы выбрать наиболее практичный и полезный в конкретном случае вариант, следует изучить разновидности конструкций и определить какие именно свойства важны в первую очередь.

Устройство стеклопакета

Стеклопакет — это конструкция из 2, 3 или 4 стекол соединенных между собой. Между ними по периметру устанавливается дистанционная рамка из алюминия или оцинкованной стали, реже пластика. Внутренние полости стеклопакета герметичны. Стыки стеклянных полотен и рамки герметизируются бутилом. Затем по всему периметру наносится второй слой герметика (силиконового или полиуретанового). Он изолирует рамку от внешней среды и обеспечивает дополнительную изоляцию внутренних полостей.

Дистанционная рамка полая с перфорацией. Внутри нее помещают гранулят, способный впитывать остаточную влагу из стеклопакета, предотвращая запотевание изнутри.

Внутренние полости стеклопакета чаще всего заполняются осушенным воздухом. Также используются другие газы, плотность которых выше — они обеспечивают более эффективную теплоизоляцию.

В пластиковом окне стеклопакеты удерживаются штапиком с резиновым уплотнительным контуром. Для нормального функционирования всей конструкции необходимо чтобы пакет был неподвижен, а резина плотно прилегала к стеклу.

Для производства стеклопакетов используется стекло марок М1, М2, М3 и другие. Полотна классифицируются по ГОСТ 111-90. Чем ниже числовое значение, тем выше качество материала: меньше искажения и дефектов на 1 кв.м. Толщина стекол чаще всего 4 мм, иногда одно из них может быть 6 мм, для улучшения звукоизоляции.

Общая толщина стеклопакета складывается из стекол и ширины дистанционных рамок. Стандартные варианты: 24, 32, 36, 40, 42 мм.

Разновидности стеклопакетов для окон ПВХ

Стеклопакеты различаются по количеству воздушных камер, по наличию дополнительных функций и виду газа между стеклами. Это основные критерии, которые помогут выбрать подходящие конструкции с учетом особенностей здания, климата в регионе, и личных предпочтений.

Количество камер

Количество камер — это количество полостей между стеклами. Выбирать по принципу: чем больше, тем лучше — не совсем верно. Важно учитывать температурный режим в помещении и климат.

Виды стеклопакетов по количеству камер:

  • Однокамерные. Конструкции из двух стекол, соединенных дистанционной рамкой. Толщина таких стеклопакетов 24 мм. Без дополнительной обработки и нанесения теплосберегающей пленки используются только в нежилых помещениях. Широко распространены в остеклении веранд, лоджий, балконов, дачных домиков, хозяйственных и промышленных площадей. Основные достоинства — невысокая стоимость, легкий вес, отличная светопропускная способность.
  • Двухкамерные. Изделия из трех стеклянных полотен и двух воздушных полостей. Толщина таких стеклопакетов от 32 до 40 мм. Это самые распространенные конструкции для жилых помещений. Отличаются хорошими изоляционными свойствами. Пропускают чуть меньше света, чем однокамерные, но для глаз это незаметно.
  • Трехкамерные. Конструкции с четырьмя стеклами. Используются только в экстремальных климатических условиях или в местах с высоким уровнем шума. Для стандартного остекления квартиры их приобретение нецелесообразно. Толщина может достигать 60 мм. Такие изделия имеют очень большой вес, сниженную светопропускную способность и существенно ускоряют износ фурнитуры окна.

Оптимальный по стоимости, весу, тепло- и шумоизоляции стеклопакет для умеренного климата — двухкамерный. В неотапливаемых помещениях можно сэкономить и установить однокамерные. Монтировать трехкамерные имеет смысл только, если температура в регионе часто опускается ниже отметки -40°C.

Дополнительные функции

Стеклопакеты из обычных стекол несовершенны. Они хрупкие, пропускают холод и шум. Поэтому производители постоянно разрабатывают способы для улучшения эксплуатационных характеристик. Некоторые виды стеклопакетов уже прочно вошли в жизнь, другие только появились и еще мало кому известны.

Энергосберегающие

Стекло на окнах — самая холодная поверхность в помещении, именно через него происходит большая часть теплопотерь. Чтобы удерживать тепло внутри помещения и не впускать холод, стеклопакеты оснащают низкоэмиссионным стеклом с i или k покрытием из оксидов металлов. Этот слой отражает тепловые лучи, возвращая их обратно в помещение, зимой сохраняя тепло, летом уберегая от перегрева. При этом напыление почти не препятствует проникновению солнечного света в помещение.

Принцип действия энергосберегающих стеклопакетов

Энергосберегающие стеклопакеты позволяют значительно экономить расходы на отоплении, снижая теплопотери с 40 до 20%, при этом их стоимость чуть выше, чем у обычных. Кроме этого, наличие в составе стеклопакета низкоэмиссионного стекла почти исключает запотевание, так как внутренняя поверхность всегда теплая. Напыление способно отражать ультрафиолетовые лучи, что продлевает срок службы отделке и мебели. Из недостатков этих изделий стоит отметить незначительное снижение светопропускной способности, более сложный процесс производства и потерю свойств покрытия при разгерметизации стеклопакета.

Важно! Теплосбережение энергосберегающего однокамерного стеклопакета выше, чем у обычного двухкамерного.

Многофункциональные

Это усовершенствованные последователи энергосберегающих стеклопакетов. Их наружное стекло покрывают несколькими слоями:

  • низкоэмиссионным напылением;
  • защитным слоем;
  • напылением, придающим оттенок и светоотражающие свойства.

Таким образом, это покрытие не только снижает теплопотери, но и придает окну привлекательный внешний вид, армирует, тонирует и защищает от яркого солнца. Такие изделия рекомендуется устанавливать на верхних этажах домов с солнечной стороны.

Самоочищающиеся

Эти стеклопакеты позволяют экономить время хозяйкам и содержать стекла в чистоте с уличной стороны в труднодоступных местах. На наружную поверхность таких конструкций наносится специальная пленка. На ней под действием ультрафиолета разрушаются органические загрязнения, а затем полностью смываются дождевой водой. На поверхности пленки не задерживаются водяные капли, поэтому стекло всегда чистое и прозрачное.

Шумоизоляционные

Улучшенные шумоизоляционные свойства стеклопакету придают разными способами. Чаще всего это использование в конструкции более толстого наружного стекла — 6 мм. И увеличенная ширина дистанционной рамки. Наружное стекло иногда заменяют триплексом из 2-х полотен, толщиной 3 мм.

Шумоизолирующими чаще всего выполняют двухкамерные стеклопакеты. Их устанавливают в местах с высоким уровнем шума, например, вблизи аэропортов, железнодорожных путей, оживленных трасс.

Ударопрочные

Остекление на первых этажах зданий, в магазинах, офисах, школах требует повышенного уровня безопасности. Здесь необходимо устанавливать прочные конструкции, которые в случае повреждения не способны поранить человека. Эти свойства достигаются несколькими способами:

  • Установкой многослойного триплекса с наружной стороны. Это несколько стекол, прочно склеенных между собой специальной пленкой или полимерным клеем. При повреждении осколки не осыпаются, а остаются на клеевой основе. Разбить такое стекло в разы сложнее, чем обычное.
  • Использованием закаленного стекла. Преимущества этого материала всем известны. Он более прочный и при повреждении рассыпается на безопасные для человека фрагменты без острых краев.
  • Бронирование пленкой. Самый недорогой вариант улучшить прочностные характеристики. На поверхность наружного стекла приклеивается защитный армирующий слой. Он повышает прочность на удар и не позволяет осколкам осыпаться при разрушении стеклопакета.
Триплекс в составе стеклопакета.

Ударопрочное стекло может стать альтернативой решеткам и ставням. Оно защищает от сильных ударов и природных бедствий, значительно повышая безопасность.

Тонированные

Для придания остеклению привлекательного и необычного вида используют тонировку. Она снижает светопропускную способность конструкции и не влияет на другие свойства стеклопакета. Тонировка защищает внутреннее пространство помещения от посторонних глаз, ультрафиолета и яркого солнечного света. Изнутри помещения наличие тонировки чаще всего почти незаметно.

Виды тонировки:

  • Нанесение пленки. Недорогой способ украсить стеклопакет, пленка приклеивается изнутри, что защищает ее от воздействия окружающей среды. Вариант хорош тем, что можно выбрать любые оттенки и эффекты. Доступные зеркальные, перфорированные и матовые пленки.
  • Окрашивание в массе. Пигмент добавляется в процессе производства и полностью окрашивает стекло. Доступны любые оттенки. Минусы способа в том, что нельзя добиться зеркальной поверхности и существенно снижается светопропускная способность.
  • Нанесение эмали. Это закаленные стекла с непрозрачным цветным покрытием. Подходят для остекления коммерческих помещений, общественных зданий. Имеют эффектный внешний вид и повышенную безопасность.

Тонированные стеклопакеты используется при остеклении высотных зданий, офисных помещений, коттеджей, балконов, лоджий, веранд, кафе.

Солнцезащитные

Солнцезащитные стеклопакеты близки к тонированным, но их главная задача — сократить уровень проникновения света в помещения и не пропускать ультрафиолетовые лучи. Поэтому к пленке, окрашиванию в массе и эмали можно добавить напыление из оксидов металлов, которое используется для изготовления мультифункциональных стекол.

«Умные»

«Умные» окна или смарт-окна — это технологии будущего, которые уже стали реальностью. Такие стеклопакеты работают от электричества, потребляют не больше одной лампочки, безопасны и многофункциональны. Виды «умных» стеклопакетов:

  • Электрообогреваемые. Это стеклопакеты с низкоэмиссионным напылением и электродами, питающимися от электросети. Это обеспечивает подогрев стекла и предотвращает выпадение конденсата.
  • Самозатемняющиеся. Уровень затемнения и прозрачности таких конструкций можно регулировать при помощи пульта.

Декоративные

Для декорирования стеклопакетов используют шпросы и фальш-переплеты. Первые представляют собой тонкие металлические рейки, их раскладывают в рисунок внутри стеклопакета. С помощью набора готовых фигурных элементов и соединений создаются красивые, уникальные узоры.

Фальш-переплеты устанавливаются на наружной части стеклопакета, реже во внутренней полости. Они визуально сегментируют окно. Такой декор подходит для загородных домов, дач, коттеджей, веранд.

Заполнение камер

Бюджетный и самый распространенный вариант газонаполнения — осушенный воздух. Реже используются инертные виды газа, такие как аргон, криптон, ксенон. Они обладают меньшей теплопроводностью. Цена на стеклопакеты с газонаполнением отличным от воздуха всегда выше. Применение инертных газов необходимо при использовании i-стекла, они не позволяют покрытию окисляться под действием кислорода.

Преимущества инертных газов:

  • Повышают сопротивление теплопередаче на 10-20%.
  • Снижают риск образования конденсата.
  • Дают возможность использовать однокамерный стеклопакет в отапливаемых помещениях.

Недостатки конструкций: даже при полной герметичности, из камеры теряется до 3% газа в год. Каждые 10 лет стеклопакет нужно менять или заполнять газом повторно. Проверить какой газ находится внутри, визуально невозможно. Кроме этого, если давление в камере недостаточное, то теплопроводность инертного газа приближается к воздуху.

Как расшифровать информацию из маркировки

Буквенно-числовая маркировка несет в себе основную информацию о стеклопакете. Чтобы избежать обмана недобросовестных продавцов, важно уметь читать формулу стеклопакета. Она может быть нанесена на наклейку на стеклопакете, на дистанционную рамку или содержаться в сопроводительной документации.

Маркировка дает информацию об основных характеристиках стекла, размерах, наличии пленок и покрытий, типу газонаполнения.

По ГОСТ 24866-2014 маркировка однокамерного стеклопакета выглядит следующим образом — 4М1х16х4М1, где:

  • 4 — это толщина стекла в мм.
  • М1 — марка стекла.
  • 16 — ширина дистанционной рамки.

Обозначение дополнительных свойств:

  • СПО — однокамерный.
  • СПД — двухкамерный.
  • К или И — твердое и мягкое низкоэмиссионное покрытие.
  • Т0 и Т1 — окрашенное в массе.
  • Р1А, Р2А, Р3А, Р4А, Р5А — ударостойкость и класс защиты.

Если в качестве заполнения использовался воздух, то дополнительное обозначение отсутствует. Аргон обозначается как Ar. Криптон — Kr.

Выбор стеклопакета и климат региона

На большей части территории России целесообразно использование двухкамерных стеклопакетов. Однокамерные подходят для остекления неотапливаемых помещений и жилых при условии наличия низкоэмиссионного стекла в структуре. Трехкамерные имеет смысл устанавливать только в регионах с суровым климатом, сильными ветрами и морозами.

Для улучшения теплоизоляции следует применять энергосберегающие конструкции. На территории с большим количеством солнечных дней — тонированные и солнцезащитные.

Чтобы не переплачивать за лишние функции, следует определить какие свойства наиболее важны в каждом отдельном случае. Если вы затрудняетесь, обратитесь к профессионалам для получения консультации.

Стеклопакеты | Окна - «VEKA»

Стеклопакеты для пластиковых окон

Основой надежности и экономической выгоды современных пластиковых окон Века является стеклопакет, который конструктивно может изготавливаться различной структуры с особыми технологическими характеристиками. Стеклопакет представляет собой несколько герметично соединенных между собой стекол с различной дистанцией и разноструктурными связками, причем сами стекла зачастую имеют специализированные покрытия или сборную структуру (триплекс). Вариации использования материалов и фурнитуры позволяют выпускать ПВХ окна Veka различной модификации, что, порой, усложняет их выбор.

Выбор стеклопакета

Выбор стеклопакета должен основываться на нескольких важных факторах:
  • Количество камер (однокамерные или двухкамерные) – чем больше камер, тем лучше проявляются звукопоглощающие и теплоотражающие качества стеклопакета, поэтому двухкамерные окна более надежны и экономически выгодны в эксплуатации.
  • Ширина стеклопакета (может составлять 24, 32, 36, 42, 44, 46 мм), которую можно условно сравнить с эксплуатационной эффективностью, т.е. чем параметр больше, тем лучше проявляются положительные технологические характеристики. Ширина зависит от количества камер, толщины используемого стекла и дистанционных рамок между камерами.
  • По функциональному назначению стеклопакеты подразделяются на простые, антивандальные и специализированные, причем сам выбор должен основываться на условиях эксплуатации окна и желаемых показателях экономической выгоды. Так, установка окон с антивандальным стеклопакетом целесообразна на первых этажах, а шумоизолирующие стеклопакеты активно устанавливаются на окна, выходящие на оживленные дороги и трассы.
Стоит отметить, что простые стеклопакеты становятся все менее популярными, т.к. их установка не несет существенной экономической выгоды в сравнении со специализированными окнами.

Особенности специализированных стеклопакетов

Самоочищающиеся стеклопакеты
Самоочищающиеся стеклопакеты имеют напыление на стекле на основе оксида титана, который проявляет катализаторные свойства при разрушении под воздействием ультрафиолета органических и неорганических загрязнений. К тому же защитное покрытие обнаруживает наносвойства – попадающая на поверхность влага не сформировывается в капли, а растягивается, что при стекании создает функцию обмывания стекла.
Мультифункциональные стеклопакеты
Мультифункциональные стеклопакеты со стеклом ClimaGuard Solar имеют двухкамерную или трехкамерную газонаполненную структуру, отвечающую самым высоким требованиям по теплоизоляции и энергосбережению. Особая структура стеклопакета выполняет функцию фильтра: в помещение проникает ультрафиолет, а инфракрасное излучение (тепло) не проходит через многослойный барьер стеклопакета, т.е. летом в комнату не проникает жара, а зимой не теряется тепло отопления.
Теплопакет EVO 2.0
Теплопакет EVO 2.0 имеет универсальное климатическое применение. Его структура основана на специализированных теплоизоляторах и полном разрыве теплопередачи между стеклами. Пакет имеет максимальную светопропускную способность.  
Шумоизоляционные стеклопакеты
Шумоизоляционные стеклопакеты высокоэффективны за счет использования разноструктурных оконных полотен (различная толщина и свойства) и различных дистанций между стеклами. Специальная структура стеклопакета эффективно поглощает вибрацию и шум до 40 дБ.
Триплекс
Триплекс-стекло относится к антивандальным оконным полотнам и состоит из двух и более стекол с промежуточной склеивающей полимерной пленкой. Стекло за счет клееной структуры выдерживает значительные ударные нагрузки и при повреждении не рассыпается, поэтому триплекс широко распространен в стеклопакетах, устанавливаемых на нижних этажах.
Что такое формула стеклопакета
Конструктивная формула — это важнейший отличительный параметр таких изделий, т. е. в определенной последовательности общепринятое перечисление толщины используемых в конструкции стёкол и расстояния между ними, указанное в миллиметрах. Например:
  • 4-16-4 — это формула однокамерного базового изделия, в конструкции которого используются: 4-х миллиметровое чистое флоат-стекло и дистанционная рамка, имеющая ширину в 16 миллиметров.
  •  4-10-4-14-4 (для Softline 70) или 4-9-4-10-4 (для Euroline 58) — это формула двухкамерного стандартного изделия.
  •  Светопроницаемые герметичные изделия, имеющие сложную конструкцию (дистанционные рамки разных толщин, стекла с различными характеристиками, внутреннее пространство камер, заполненное аргоном) могут обозначаться, например, так: 4i-16a-4.
Конструкции с энергосберегающими свойствами
Энергосберегающие светопроницаемые стеклопакеты изготавливаются с использованием i-стекла (т. е. низкоэмиссионного), покрытого специальным составом, который наносится методом вакуумного напыления. Такое стекло отлично пропускает внутрь помещения солнечное (коротковолновое) излучение, при этом препятствует выходу наружу теплового (длинноволнового) излучения, — например от радиатора отопления или любого другого отопительного прибора. Это существенно уменьшает потери тепла.
«Краевые зоны»: профильная система + светопроницаемая герметичная конструкция
Глубина установки стеклопакета является важным параметром, и именно он был изменён в новых системах VEKA. А определяет этот параметр глубину «захода» конструкции внутрь створки. Как правило, в обычных профилях, имеющих ширину в 70 мм, этот показатель равен 18 мм. При этом в энергосберегающей системе SOFTLINE, от немецкого концерна VEKA, он составляет 21 мм. Казалось бы, такие несущественные (на первый взгляд!) 3 мм — становятся решающими, если речь идёт об установке окон в условиях континентального климата с повышенной ветровой нагрузкой и сильными температурными колебаниями. Однако именно металлическая дистанционная рамка в светопроницаемой герметичной конструкции является одним из самых существенных проводников холода. Именно поэтому, благодаря её перемещению в более теплую зону значительно снижается риск понижения температуры краевых зон системы.

Стоимость

Уточнить наличие, цены, а так же получить информацию по действующим акциям, Вы можете на сайте компании и в нашем интернет магазине. Наиболее точную стоимость заказа можно просчитать только после выезда инженера на замер, и согласования всех дополнительных деталей Вашего заказа.

Как заказать?

Это просто – обратитесь в компанию «Окна ВЕКА», позвоните нам или закажите обратный звонок прямо с сайта, оформите заявку на замер. С Вами свяжутся наши специалисты, ответят на все Ваши вопросы, при необходимости к Вам приедет специалист, сделает необходимые замеры, согласует детали и после этого сделает предложение по стоимости, согласует условия договора.

Наши преимущества — Ваша выгода

Ждем Вашего звонка:

+7 (861) 290-49-05
+7 (928) 210-49-05
+7 (800) 300-57-55

跳至 內容 的 開始
  • 聯絡 我們
  • 文字 大小
  • 简体
  • РУС
百 樓 圖 網 屋宇署 香港特別行政區 政府 桌上 Version 網站 搜尋 搜尋

流動 Version 目錄

  • 主頁

  • 最新 消息
    • 新聞公報
    • 資料
    • 活動 及 宣傳
    • 招標 公告
    • 命令 的 狀況
  • 建築工程
    • 新建 樓宇
    • 改動 及 加 建
    • 小型 工程
    • 招牌
    • 地盤 監察
  • 樓宇 安全 及 檢驗
    • 強制 驗 樓 計劃
    • 強制 驗 窗 計劃
    • 僭建物
    • 樓宇 安全
    • 斜坡 安全
    • 消防 安全
    • 財政 資助
    • 支援
  • 資源
    • 表格
    • 網上 服務
      • 百 樓 圖 網 - 網上 樓宇 記錄
      • 搜尋 註冊 名單
      • 搜尋 驗 樓 / 驗 窗 通知 及 消防 安全 指示
      • 流動 應用 程式
    • 註冊
    • 小冊子
    • 渠 管 健康
    • 守則 及 參考資料
      • 守則 , 設計 手冊 及 指引
      • 作業 備考 及 通告 函件
      • 中央 資料 庫 (只 提供 英文 Version)
      • 「組裝 合成」 建築 法
    • 索取 公開 資料
    • 法律
    • 常見 問題
  • 關於 我們
    • 歡迎辭
    • 我們 的 服務
    • 環保 措施
    • 組織
    • 專業 / 技術 人才
    • 樓宇 資訊 中心
    • 聯絡 我們

目錄

關 上 目錄 流動 Version 網站 搜尋 搜尋
  • 简体
  • РУС
  • 聯絡 我們

對不起 , 我們 找不到 你 要 的 網頁。

請 嘗試 以下 連結 或

返回 主頁 返回 頁首

快速 連結

建築工程

  • 新建 樓宇
  • 小型 工程
  • 招牌

樓宇 安全 及 檢驗

  • 強制 驗 樓 計劃
  • 強制 驗 窗 計劃
  • 僭建物
  • 樓宇 安全
  • 財政 資助

資源

  • 在 私人 發展 項目 內 的 總 樓面 面積 寬 免 摘要
  • 《建築物 條例》 - 五: 附表 所列 地區
  • 公眾
  • 就 過渡 性 房屋 措施 批予 的 變通 或 豁免
  • 常見 條件 及 規定
  • 渠 管 健康
  • 常見 問題

更新

  • 命令 的 最新 狀況
  • 處理 未獲 遵從 命令 的 最新 目標
  • 招標
  • 資料
  • 新聞公報
  • 2018 © 屋宇署
  • 重要
  • 私隱
  • 網頁

клинических характеристик 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 г.

, в Ухане, Китай | Реанимационная медицина | JAMA
Ключевые моменты

Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом (2019-nCoV) 2019 г., в Ухане, Китай?

Выводы В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов потребовали госпитализации в отделение интенсивной терапии и 4 пациента.3% умерли. Предполагаемая передача 2019-nCoV от человека человеку в больнице подозревалась у 41% пациентов.

Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой передачей в больнице, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличивалось, но информация о клинических характеристиках больных ограничена.

Объектив Описать эпидемиологические и клинические характеристики NCIP.

Дизайн, обстановка и участники Ретроспективная одноцентровая серия случаев 138 последовательных госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г .; окончательная дата наблюдения - 3 февраля 2020 г.

Открытия Документировано NCIP.

Основные результаты и мероприятия Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, радиологические и лечебные данные. Сравнивались исходы пациентов в критическом и некритическом состоянии. Предполагаемая передача в больнице подозревалась, если заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и можно было отследить возможный источник инфекции.

Результаты Из 138 госпитализированных пациентов с NCIP средний возраст составлял 56 лет (межквартильный размах, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Связанная с больницей передача подозревалась как предполагаемый механизм инфекции для затронутых медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали лихорадку (136 [98,6%]), усталость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (количество лимфоцитов 0,8 × 10 9 / л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), увеличенное протромбиновое время (13,0 секунды [IQR, 12,3-13,7]) - у 80 пациентов (58%) и повышенное содержание лактатдегидрогеназы (261 Ед / л [IQR, 182- 403]) у 55 пациентов (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или матовое стекло в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%], цефтриаксон, 34 [24,6%], азитромицин, 25 [18.1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение интенсивной терапии (ОИТ) из-за осложнений, включая синдром острого респираторного дистресс-синдрома (22 [61,1%]), аритмию (16 [44,4%]) и шок (11 [30,6%]). %]). Среднее время от появления первых симптомов до одышки составляло 5,0 дней, до госпитализации - 7,0 дней и до ОРДС - 8,0 дней. Пациенты, проходившие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не проходившими лечение в отделении интенсивной терапии (n = 102), были старше (средний возраст 66 лет против 51 года), с большей вероятностью имели сопутствующие заболевания (26 [72.2%] против 38 [37,3%]), и у них чаще была одышка (23 [63,9%] против 20 [19,6%]) и анорексия (24 [66,7%] против 31 [30,4%]). Из 36 пациентов в отделении интенсивной терапии 4 (11,1%) получали высокопоточную кислородную терапию, 15 (41,7%) получали неинвазивную вентиляцию и 17 (47,2%) получали инвазивную вентиляцию (4 были переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля 47 пациентов (34,1%) были выписаны и 6 умерли (общая летальность 4,3%), но остальные пациенты все еще госпитализированы. Среди выписанных живыми (n = 47) средняя продолжительность пребывания в больнице составила 10 дней (IQR, 7.0-14,0).

Выводы и актуальность В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

Quiz Ref ID В декабре 2019 года в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, ныне известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Болезнь быстро распространилась из Ухани в другие районы. По состоянию на 31 января 2020 года в Китае подтверждено 9692 случая заболевания NCIP. На международном уровне случаи заболевания зарегистрированы в 24 странах и 5 континентах. 6 3 января 2020 года новый коронавирус 2019 года (2019-nCoV) был идентифицирован в образцах жидкости бронхоальвеолярного лаважа от пациента в Ухане и был подтвержден как причина NCIP. 7 Полногеномное секвенирование и филогенетический анализ показали, что 2019-nCoV отличается от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (SARS) и ближневосточным респираторным синдромом (MERS) у человека. 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и был отнесен к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было высказано предположение, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что его распространение среди людей произошло через передачу от диких животных, незаконно продаваемых на оптовом рынке морепродуктов Хуанани. 8

Хуанг и др. 9 впервые сообщили о 41 случае NCIP, в котором большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Хуанань.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальное или пониженное количество лейкоцитов и рентгенологические признаки пневмонии. В тяжелых случаях может наступить дисфункция органов (например, шок, острый респираторный дистресс-синдром [ОРДС], острое повреждение сердца и острое повреждение почек) и смерть. 9 Впоследствии Чен и др. 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями , и может привести к ОРДС.Однако о различиях в клинических характеристиках тяжелых и нетяжелых случаев не сообщалось. Отчеты о случаях подтвердили передачу NCIP от человека к человеку. 10 , 11 В настоящее время нет эффективных методов лечения или вакцин против NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ICU), с нетяжелыми случаями, которые не получали помощь ICU.

Дизайн исследования и участники

Quiz Ref ID Эта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). Были включены все последовательные пациенты с подтвержденным NCIP, госпитализированные в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 г.Устное согласие было получено от пациентов. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из основных больниц третичного уровня обучения и отвечает за лечение для NCIP, назначенное правительством. Всем пациентам с NCIP, включенным в это исследование, был поставлен диагноз в соответствии с временными рекомендациями Всемирной организации здравоохранения. 12 Клинические результаты (т.е. выписки, смертность, продолжительность пребывания) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

Медицинские карты пациентов были проанализированы исследовательской группой отделения реанимации больницы Чжуннань Уханьского университета. Эпидемиологические, клинические, лабораторные и радиологические характеристики, а также данные о лечении и исходах были получены с помощью форм для сбора данных из электронных медицинских карт. Данные были проанализированы обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, кортикостероидную терапию, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, компьютерная томография грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с Берлинским определением. 13 Острое повреждение почек было идентифицировано в соответствии с определением «Болезнь почек: улучшение глобальных результатов». 14 Поражение сердца определялось, если уровни сердечных биомаркеров (например, тропонина I) в сыворотке крови превышали верхний референсный предел 99-го перцентиля или при электрокардиографии и эхокардиографии были обнаружены новые аномалии. 9 Для пациентов, поступивших в отделение интенсивной терапии, в день поступления в отделение интенсивной терапии определялись баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического здоровья. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и поступления в ОИТ.

Предполагаемая передача в больнице подозревалась, если группа медицинских работников или госпитализированных пациентов в одних и тех же палатах заразилась в течение определенного периода времени, и возможный источник инфекции можно было отследить.

Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

Было собрано

образцов мазков из горла для извлечения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора с 150 мкл раствора для сохранения вируса, и общую РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторного образца (Zhongzhi, Wuhan, China).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим перемешиванием на вортексе в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об / мин в течение 5 минут. Суспензию использовали для анализа РНК 2019-nCoV с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР). Два гена-мишени, включая открытую рамку считывания 1ab ( ORF1ab ) и белок нуклеокапсида (N), были одновременно амплифицированы и протестированы в ходе анализа RT-PCR в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5'-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3 '. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3 '. Анализ ОТ-ПЦР в реальном времени выполняли с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров для зонда, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ ОТ-ПЦР выполняли в следующих условиях: инкубация при 50 ° C в течение 15 минут и 95 ° C в течение 5 минут, 40 циклов денатурации при 94 ° C в течение 15 секунд и увеличение и сбор сигнала флуоресценции при 55 ° C в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 было определено как положительный результат теста, а значение Ct 40 или более было определено как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http: // ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

Категориальные переменные были описаны как частота и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианного и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием независимой группы тестов t , когда данные были нормально распределены; в противном случае использовали тест Манна-Уитни.Данные (ненормальное распределение) от повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Пропорции категориальных переменных сравнивались с использованием критерия χ 2 , хотя точный критерий Фишера использовался, когда данные были ограничены. Все статистические анализы были выполнены с использованием программного обеспечения SPSS (Статистический пакет для социальных наук) версии 13.0 (SPSS Inc). Для нескорректированных сравнений статистически значимым считалось двустороннее значение α менее 0,05. Анализы не корректировались для множественных сравнений, и, учитывая возможность ошибки типа I, результаты следует интерпретировать как исследовательские и описательные.

Представление характеристик

В исследуемую популяцию вошли 138 госпитализированных пациентов с подтвержденным NCIP. Средний возраст составлял 56 лет (IQR, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Из них 102 (73,9%) были помещены в изоляторы, 36 (26.1%) поступили и переведены в ОИТ из-за развития органной дисфункции (таблица 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составляла 5 дней (IQR, 1-10), 7 дней (IQR, 4-8) и 8 дней (IQR, 6-12), соответственно (Таблица 1 ). Из 138 пациентов 64 (46,4%) имели одно или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее частыми сопутствующими состояниями.

Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), усталость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (Таблица 1). В общей сложности 14 пациентов (10,1%) первоначально поступили с диареей и тошнотой за 1-2 дня до развития лихорадки и одышки.

По сравнению с пациентами, которые не получали помощи в ОИТ (n = 102), пациенты, которым требовалась помощь в ОИТ (n = 36), были значительно старше (средний возраст 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37- 62]; P <.001) и чаще имели сопутствующие заболевания, включая артериальную гипертензию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%])), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярных заболеваний (6 [16,7%] против 1 [1,0%]). По сравнению с пациентами, не получавшими ОИТ, пациенты, поступившие в ОИТ, чаще жаловались на боль в глотке, одышку, головокружение, брюшную полость. боль и анорексия.

Показатели жизнедеятельности и лабораторные параметры у пациентов в отделениях интенсивной терапии и не в отделениях интенсивной терапии

Частота сердечных сокращений, частота дыхания и среднее артериальное давление не различались между пациентами, которые получали помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в больницу для всех пациентов, а затем разделялись на тех, кто позже был помещен в отделение интенсивной терапии или нет. Были обнаружены многочисленные различия в лабораторных результатах между пациентами, поступившими в отделение интенсивной терапии, и теми, кто не поступил в отделение интенсивной терапии (таблица 2), включая более высокие уровни лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 включенных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до поступления в ОИТ составляло 10 дней (IQR, 6–12) (Таблица 3).В день поступления в ОИТ - медиана шкалы комы Глазго; Острая физиология и оценка хронического здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9-15), 17 (IQR, 10-22) и 5 ​​(IQR, 3-6), соответственно (Таблица 3). Среднее парциальное давление кислорода составляло 68 мм рт. Ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составляла 136 мм рт. Ст. (IQR, 103–234).

Дисфункции органов и основные вмешательства

Дисфункция органов и лечение 138 пациентов показаны в таблице 4.По состоянию на 3 февраля 2020 года 85 пациентов (61,6%) все еще были госпитализированы. Всего было выписано 47 пациентов (34,1%), 6 пациентов (4,3%) умерли. Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты и 6 умерли. Из 11 пациентов, оставшихся в отделении интенсивной терапии, 6 получили инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​- на неинвазивную вентиляцию легких). Среди 138 пациентов частыми осложнениями был шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмии (23 [16,7%]) и острого сердечного повреждения (10 [7,2%]). Пациенты, которые получали лечение в отделении интенсивной терапии, имели больше шансов иметь одно из этих осложнений, чем пациенты, не находящиеся в отделении интенсивной терапии.

Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород, а 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная механическая вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых получали экстракорпоральную мембранную оксигенацию в качестве неотложной терапии. В общей сложности 13 пациентов получали вазопрессоры, а 2 пациента получали заместительную почечную терапию.

Динамический профиль лабораторных данных у пациентов с NCIP

Чтобы определить основные клинические признаки, которые проявлялись во время прогрессирования NCIP, динамические изменения 6 клинических лабораторных параметров, включая гематологические и биохимические параметры, отслеживались с 1 по 19 день после начала заболевания с двухдневными интервалами.В конце 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов наблюдалась выраженная лимфопения, а у не выживших со временем развивалась более тяжелая лимфопения. Количество лейкоцитов и нейтрофилов у не выживших было выше, чем у выживших. Уровень D-димера был выше у выживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического статуса уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

Предполагаемая передача и инфекция в больнице

Из 138 пациентов 57 (41,3%) предположительно были инфицированы в больнице, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 - из терапевтического и 5 - из онкологического.Из инфицированных медицинских работников 31 (77,5%) работали в палатах общего профиля, 7 (17,5%) - в отделении неотложной помощи и 2 (5%) - в отделении интенсивной терапии. У одного пациента в текущем исследовании появились абдоминальные симптомы, и он был госпитализирован в хирургическое отделение. Предположительно, более 10 медицинских работников этого отделения заразились этим пациентом. Также предполагалось, что произошла передача инфекции от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одной палате были инфицированы, и все они имели атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем пациент был изолирован. Впоследствии у других 3 пациентов в том же отделении поднялась температура, появились абдоминальные симптомы, и им был поставлен диагноз инфекции nCoV.

Quiz Ref ID Этот отчет, насколько нам известно, представляет собой самую крупную на сегодняшний день серию случаев госпитализированных пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в отделении интенсивной терапии, 34.1% были выписаны, 6 умерли (4,3%), 61,6% остаются госпитализированными. Для выписанных (n = 47) пребывание в стационаре составило 10 дней (IQR, 7,0–14,0). Время от появления одышки составляло 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Обычными симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально наблюдались атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачность матового стекла были типичным признаком компьютерной томографии для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась кислородная терапия, а меньшинство пациентов нуждались в инвазивной вентиляции или даже экстракорпоральной мембранной оксигенации.

Quiz Ref ID Данные этого исследования предполагают, что могла иметь место быстрая передача 2019-nCoV от человека человеку. Основная причина заключается в оценке основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется на новых людей, она воспроизводится; R 0 указывает среднее количество дополнительных лиц, которых заражает один больной в течение его болезни, и конкретно относится к группе людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что свидетельствует о том, что в среднем каждый пациент распространял инфекцию на 2.2 других человека. 15 Одна из причин быстрого распространения может быть связана с нетипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

Недавнее исследование показало, что нКоВ был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако трудно дифференцировать и обследовать пациентов с атипичными симптомами. Тем не менее, быстрая передача от человека к человеку среди близких контактов является важной особенностью пневмонии nCoV. 10 , 11,15

Пациенты, поступившие в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не получавшими ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение заключается в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками-мужчинами.По сравнению с симптомами у пациентов, не находящихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам идентифицировать пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому что случаи в предыдущем исследовании были на ранней стадии эпидемии NCIP, а текущие случаи - из стадия вспышки.

Наиболее частыми лабораторными отклонениями, наблюдаемыми в этом исследовании, были пониженное количество лимфоцитов, увеличенное протромбиновое время и повышенная лактатдегидрогеназа. По сравнению с пациентами, не входящими в ОИТ, пациенты, которые получали лечение в ОИТ, имели многочисленные лабораторные отклонения. Эти отклонения предполагают, что инфекция 2019-nCoV может быть связана с клеточным иммунодефицитом, активацией коагуляции, повреждением миокарда, повреждением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией БВРС-КоВ и ТОРС-КоВ.

Динамический профиль лабораторных данных отслеживался у 33 пациентов с NCIP (5 не выживших и 28 выживших). У не выживших количество нейтрофилов, D-димер, уровни мочевины в крови и креатинина продолжали расти, а количество лимфоцитов продолжало снижаться до наступления смерти. Нейтрофилия может быть связана с цитокиновым штормом, вызванным вирусной инвазией, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

Quiz Ref ID До сих пор не рекомендовалось никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этой болезни заключается в борьбе с источником инфекции; использование мер индивидуальной защиты для снижения риска передачи; и ранняя диагностика, изоляция и поддерживающее лечение пораженных пациентов. Антибактериальные средства неэффективны.Кроме того, не было обнаружено, что противовирусные агенты приносят пользу при лечении SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировалась в зависимости от тяжести заболевания. Однако никаких эффективных результатов не наблюдалось.

Это исследование имеет несколько ограничений. Во-первых, образцы дыхательных путей были использованы для диагностики NCIP с помощью RT-PCR.Сыворотка пациентов для оценки виремии не бралась. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, передачу / инфекцию в больницах нельзя было окончательно доказать, но это предполагалось и предполагалось на основании времени и характера контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, из 138 случаев большинство пациентов все еще госпитализированы на момент подачи рукописи.Следовательно, трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением болезни.

В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

Авторы, отвечающие за переписку: Чжиюн Пэн, доктор медицины, отделение реанимации (pengzy5 @ hotmail.com) и Синхуан Ван, доктор медицины, отделение урологии ([email protected]), больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

Принято к публикации: 3 февраля 2020 г.

Опубликовано в Интернете: 7 февраля 2020 г. doi: 10.1001 / jama.2020.1585

Исправление: Эта статья была исправлена ​​20 февраля 2020 г., чтобы добавить правильные данные для пациенток в Таблице 1.

Вклад авторов: Доктора Д.Ван и Пэн имели полный доступ ко всем данным в исследовании и несли ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и имеют первое авторство. Доктора Пэн и X. Ван внесли равный вклад в эту статью.

Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Сбор, анализ или интерпретация данных: Д. Ван, К. Ху, Чжу, Лю, Чжан, Б. Ван, Сян, Чэн, Сюн, Пэн.

Составление рукописи: Д. Ван, К. Ху, Сян, Сюн, Ли, Пэн.

Критический пересмотр рукописи на предмет важного интеллектуального содержания: Д. Ван, Б. Ху, Чжу, Лю, Чжан, Б. Ван, Чэн, Сюн, Чжао, X. Ван, Пэн.

Статистический анализ: C. Ху, Чжу, Лю, Б. Ван, Сюн.

Получено финансирование: Д. Ван, Пэн.

Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

Наблюдение: Б. Ху, Сюн, Чжао, X. Ван, Пэн.

Раскрытие информации о конфликте интересов: Не сообщалось.

Финансирование / поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 доктору Д. Вангу; гранты 81772046 и 81971816 доктору Пэну) и Специальным проектом по значительным исследованиям и разработкам новых лекарственных средств в крупном национальном масштабе. Научно-технические проекты Китая (2020ZX0

07 доктору Пэну).

Роль спонсора / спонсора: Спонсоры не играли никакой роли в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

1.Lu H, Страттон CW, Тан YW. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi: 10.1002 / jmv.25678PubMedGoogle Scholar2.Hui DS, я Азхар Э, Мадани TA, и другие. Сохраняющаяся угроза эпидемии нового коронавируса 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.]. Int J Заразить Dis . 2020; 91: 264-266. DOI: 10.1016 / j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван W, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.]. Ланцет . DOI: 10.1016 / S0140-6736 (20) 30211-7PubMedGoogle Scholar10.Chan JF-W, юань S, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 года]. Ланцет . 2020; S0140-6736 (20) 30154-9. DOI: 10.1016 / S0140-6736 (20) 30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг QC, и другие. Ввоз и передача от человека к человеку нового коронавируса во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMc2001272PubMedGoogle Scholar13.Ranieri В.М., Рубенфельд GD, Томпсон BT, и другие; Рабочая группа по определению ARDS. Синдром острого респираторного дистресса: берлинское определение. ДЖАМА . 2012; 307 (23): 2526-2533. doi: 10.1001 / jama.2012.5669PubMedGoogle Scholar 14. Заболевание почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Руководство KDIGO по клинической практике при острой почечной недостаточности. Почки Int Suppl . 2012; 2: 1.Google ScholarCrossref 15.Ли Q, Гуань X, Wu П, и другие. динамика ранней передачи новой пневмонии, инфицированной коронавирусом, в Ухане, Китай. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi: 10.1056 / NEJMoa2001316PubMedGoogle Scholar16.Zhang H, Кан ZJ, Гонг Привет, и другие. Пищеварительная система - потенциальный путь заражения нКоВ 2019: биоинформатический анализ, основанный на одноклеточных транскриптомах. Препринт. Опубликовано 31 января 2020 г.bioRxiv 927806. DOI: 10.1101 / 2020.01.30.927806

Обзор стеклоиономерных цементов для клинической стоматологии

J Funct Biomater. 2016 сен; 7 (3): 16.

Шаранбир К. Сидху

1 Здоровье полости рта взрослых, Институт стоматологии, Лондонский университет Королевы Марии, Лондон E1 2AD, Великобритания; [email protected]

Джон В. Николсон

2 Стоматологические физические науки, Институт стоматологии, Лондонский университет Королевы Марии, Лондон E1 2AD, Великобритания

3 Центр биоматериалов Bluefield, Лондон EC1N 8JY, Великобритания

Джеймс Китхон Цой, научный редактор

1 Здоровье полости рта у взрослых, Институт стоматологии, Лондонский университет Королевы Марии, Лондон E1 2AD, Великобритания; ку[email protected]

2 Стоматологические физические науки, Институт стоматологии, Лондонский университет королевы Марии, Лондон E1 2AD, Великобритания

3 Центр биоматериалов Bluefield, Лондон EC1N 8JY, Великобритания

Поступила в 2016 г. 3 мая; Принято 21 июня 2016 г.

Авторские права © 2016 авторов; лицензиат MDPI, Базель, Швейцария. Эта статья цитировалась в других статьях в PMC.

Abstract

Эта статья представляет собой обновленный обзор опубликованной литературы по стеклоиономерным цементам и охватывает их структуру, свойства и клиническое применение в стоматологии с акцентом на результаты последних пяти лет или около того.Показано, что стеклоиономеры затвердевают в результате кислотно-щелочной реакции в течение 2–3 минут и образуют твердые, достаточно прочные материалы с приемлемым внешним видом. Они выделяют фторид и являются биоактивными, поэтому постепенно образуют прочный, прочный межфазный ионообменный слой на границе с зубом, который отвечает за их адгезию. Также описаны модифицированные формы стеклоиономеров, а именно модифицированные смолой стеклоиономеры и стеклянный карбомер, а также их свойства и области применения. Показано, что физические свойства стеклоиономеров, модифицированных смолой, являются хорошими и сравнимы с физическими свойствами обычных стеклоиономеров, но биосовместимость несколько ухудшается из-за присутствия компонента смолы, 2-гидроксиэтилметакрилата.Свойства стеклянного карбомера, по-видимому, немного уступают свойствам лучших современных обычных стеклоиономеров, и пока нет достаточной информации, чтобы определить, как сравнивается их биоактивность, хотя они были разработаны для улучшения этой конкретной характеристики.

Ключевые слова: стеклоиономерный цемент , высвобождение фторидов, биоактивность, клиническое применение, модифицированная смолой, стеклянный карбомер.

1. Введение

Стеклоиономерные цементы относятся к классу материалов, известных как кислотно-щелочные цементы.В их основе лежит продукт реакции слабых полимерных кислот с порошковыми стеклами основного характера [1]. Отверждение происходит в концентрированных растворах в воде, и окончательная структура содержит значительное количество непрореагировавшего стекла, которое действует как наполнитель для усиления затвердевшего цемента.

Термин «стеклоиономер» применялся к ним в самой ранней публикации [2], но это не совсем правильно. Собственное название для них, согласно Международной организации по стандартизации (ISO), - «стеклополиалкеноатный цемент» [3], но термин «стеклоиономер» (включая дефис) признан приемлемым тривиальным названием [4], и широко используется в стоматологии.

2. Состав

Стеклоиономерный цемент состоит из трех основных ингредиентов: полимерной водорастворимой кислоты, основного (выщелачиваемого ионами) стекла и воды [4]. Обычно они представлены в виде водного раствора полимерной кислоты и тонкоизмельченного стеклянного порошка, которые смешиваются подходящим способом с образованием вязкой пасты, которая быстро затвердевает. Однако существуют альтернативные составы, которые варьируются от кислоты и стекла, присутствующих в порошке, и чистой воды, добавляемой для отверждения, до составов, в которых часть кислоты смешивается со стеклянным порошком, а остальная часть присутствует в развести раствор в воде.Этот раствор используется в качестве жидкого компонента при формировании пасты для схватывания. Эффект от этих различий не ясен, потому что эти составы являются запатентованными, поэтому точное количество каждого компонента широко не известно. Однако, по-видимому, не наблюдается очевидного влияния на конечные свойства представления этих материалов с компонентами, по-разному распределенными между порошковой и водной фазами.

Стеклоиономерные цементы можно смешивать с помощью шпателя на подушке или стеклянном блоке, так называемое ручное перемешивание.Материал также может быть представлен в специальной капсуле, разделенной мембраной. Мембрана разрушается непосредственно перед смешиванием, и капсула быстро встряхивается в специально разработанном автоматическом миксере. При этом происходит перемешивание цемента, после чего свежеприготовленная паста выдавливается из капсулы и используется для внутриротового применения.

Если одна торговая марка доступна как в версии для смешивания вручную, так и в капсулированной версии, два типа цемента должны быть приготовлены по-разному. Цементная паста, которая схватывается за удовлетворительное время при ручном перемешивании, слишком быстро затвердевает при вибрационном перемешивании.В результате составы для капсулирования должны быть менее реактивными, чем составы для ручного смешивания, и они полагаются на ускоряющий эффект автоматического смешивания, чтобы обеспечить им удовлетворительное время работы и схватывания.

3. Полимерные кислоты

Полимеры, используемые в стеклоиономерных цементах, представляют собой полиалкеновые кислоты, либо гомополимер поли (акриловой кислоты), либо 2: 1 сополимер акриловой кислоты и малеиновой кислоты. Поли (винилфосфоновая кислота) изучалась как потенциальный цементообразователь [5], но ее практическое использование ограничено одной торговой маркой, где она используется в смеси с поли (акриловой кислотой) и эффективно действует как модификатор скорости схватывания. [6].

В литературе существует неясность относительно того, какие полимеры используются в стеклоиономерных цементах. Это связано с тем, что ранние исследования изучали ряд мономеров моно-, ди- и трикарбоновых кислот в полимерах для образования цемента, включая итаконовую и трикарбаллиловую кислоты [7]. Это заставило некоторых авторов предположить, что эти вещества должны использоваться в практических цементах. Однако это не так, и в коммерческих цементах используется либо гомополимер, либо сополимер акриловой кислоты.

Полимер влияет на свойства стеклоиономерного цемента, образующегося из них.Высокая молекулярная масса увеличивает прочность затвердевшего цемента, но растворы высокомолекулярных полимеров имеют высокую вязкость, что затрудняет их смешивание. Поэтому молекулярные веса выбираются для уравновешивания этих конкурирующих эффектов. Считается, что оптимальные свойства достигаются при средней молекулярной массе 11 000 (среднечисловая) и 52 000 (среднемассовая) [8]. Эти значения дают полидисперсность 4,7 [8].

Цементы, приготовленные из гомополимеров акриловой кислоты, демонстрируют повышение прочности на сжатие в первые 4–6 недель.С другой стороны, цементы, изготовленные из сополимеров акриловой и малеиновой кислоты, демонстрируют повышение прочности на сжатие до определенного значения, но затем происходит снижение до достижения равновесного значения. Прочность на сжатие не является фундаментальным свойством материалов, поскольку сжатие вызывает сложное разрушение образца в направлениях, приблизительно перпендикулярных сжимающей силе. Однако эти изменения измеренной прочности на сжатие указывают на то, что материал продолжает претерпевать медленные изменения с течением времени.В частности, это снижение объясняется более высокой плотностью сшивки, которая развивается в сополимерных цементах по сравнению с цементами на основе гомополимера акриловой кислоты [9]. Однако при клиническом использовании это различие между гомополимерным и сополимерным цементами не кажется важным, и нет никаких доказательств того, что цементы, изготовленные из сополимера акриловой / малеиновой кислоты, менее удовлетворительны в эксплуатации.

4. Стекла

Очень важно, чтобы стекла для иономерных цементов были основными, т.е.е., способный реагировать с кислотой с образованием соли. В принципе, можно приготовить несколько различных составов стекла, которые удовлетворяют этому требованию, но на практике полностью удовлетворительными являются только алюмосиликатные стекла с добавками фторидов и фосфатов. Коммерческие стекла для стеклоиономерных цементов обычно основаны на соединениях кальция с некоторым дополнительным содержанием натрия. Есть также материалы, в которых кальций заменен стронцием.

Иономерные стекла своим основным характером обязаны тому факту, что для их приготовления используются как оксид алюминия, так и диоксид кремния.Стекла на основе одного диоксида кремния не обладают реакционной способностью, а также основностью, поскольку их структура содержит в основном тетраэдры SiO 4 , соединенные по углам с образованием цепочек, не несущих заряда. Когда добавляется оксид алюминия, алюминий вынужден принять геометрию, аналогичную четырехгранной тетраэдрической геометрии кремния, то есть тетраэдрам AlO 4 . Поскольку алюминий несет формальный заряд 3+, он не противодействует влиянию отрицательно измененных атомов кислорода так же эффективно, как кремний с его формальным зарядом 4+. Чтобы уравновесить это, должны присутствовать дополнительные катионы, такие как Na + и Ca 2+ (или Sr 2+ ).Они создают основной характер и делают стекло уязвимым для кислот.

Фторид также является жизненно важным компонентом стекол, используемых в стеклоиономерных цементах. Стекла, содержащие фторид, были одними из первых, о которых сообщалось, когда впервые были описаны стеклоиономеры, и были либо системой SiO 2 -Al 2 O 3 -CaF 2 , либо более сложной системой SiO 2 -Al 2 O 3 -P 2 O 5 -CaO-CaF 2 система [10].Пример состава показан на рисунке для стекла, известного как G338, которое похоже на несколько коммерческих иономерных стекол.

Таблица 1

Состав стекла G338.

Компонент % по массе
SiO 2 24.9
Al 2 O 3 14.2 14 9025 9037
CaF 2 12.8
NaAlF 6 19,2
AlPO 4 24,2

Практические иономерные стекла, включая G338, как известно, претерпевают фазовое разделение, по крайней мере, при частичном охлаждении . Это приводит к участкам различного состава и, как правило, к возникновению одной фазы, которая более восприимчива к воздействию кислоты, чем другие. В принципе, можно было бы ожидать, что это изменит оптические свойства стекла и, в свою очередь, цемента, но исследований, посвященных этому вопросу, не проводилось.

Исследования иономерных стекол были проведены с использованием спектроскопии MAS-ЯМР, и они предоставили полезную структурную информацию об этих материалах. Было показано, что алюминий присутствует как в 4-, так и в 5-координации в различных стеклах [11,12], что подтверждает влияние кремнезема на координационное состояние алюминия [12]. В этих стеклах фтор присутствует исключительно в связанном с алюминием [13].

Замещение кальция на стронций в стеклах этого типа может быть достигнуто при использовании соединений SrO и SrF 2 вместо CaO и CaF 2 в стеклообразующей смеси [14].Стронций увеличивает рентгеноконтрастность по сравнению с кальцием в этих стеклах без какого-либо неблагоприятного воздействия на внешний вид этих цементов. Эти цементы усиливают выделение фторидов, хотя причина этого не известна.

5. Хелатирующие добавки

Несколько возможных соединений были изучены как добавки, модифицирующие скорость, в количестве 5% или 10% по массе в цементах [15]. Два из них оказались весьма успешными, а именно (+) - винная кислота и лимонная кислота, и из них (+) - винная кислота оказалась более эффективной.

Причины этого не ясны. Это может иметь какое-то отношение к его способности предотвращать осаждение солей алюминия, что он делает, хелатируя ионы Al 3+ и удерживая их в растворе [16]. По этому механизму он может предотвратить преждевременное образование ионных поперечных связей с участием Al 3+ [17]. Конечно, это согласуется с тем фактом, что полосы из-за полиакрилата алюминия появляются позже, когда присутствует винная кислота, чем когда она отсутствует. Полосы, возникающие из различных возможных карбоксилатов металлов, находятся в различных областях инфракрасного спектра, как показано на.

Таблица 2

Инфракрасные полосы поглощения.

909. [PubMed] [CrossRef] [Google Scholar] 32. Джексон Г. Существование AlF 4 - в водном растворе и его отношение к реакции фосфорилазы. Неорг. Chem. Acta. 1988. 151: 273–276. DOI: 10.1016 / S0020-1693 (00) -0. [CrossRef] [Google Scholar] 33. Наг Г., Надь Л. Глава 6, Галогены. В: Ноллет Л.М.Л., редактор. Справочник по анализу воды. 2-е изд. CRC Press; Бак Ратон, Флорида, США: 2007. С. 157–200. [Google Scholar] 34. Льюис С.М., Коулман Н.Дж., Бут С.Э., Николсон Дж.W. Взаимодействие комплексов фторида алюминия, полученных из стеклоиономерных цементов, с гидроксиапатитом. Ceram. Силик. 2013; 57: 196–200. [Google Scholar] 35. Фезерстон Дж.Д. Профилактика и лечение кариеса зубов: роль низкоуровневого фторида. Comm. Вмятина. Oral Epidemiol. 1999; 27: 31–40. DOI: 10.1111 / j.1600-0528.1999.tb01989.x. [PubMed] [CrossRef] [Google Scholar] 36. Hicks J., Garcia-Gody F., Flaitz C. Биологические факторы кариеса зубов: роль реминерализации и фторида в динамическом процессе деминерализации и реминерализации (часть 3) Дж.Clin. Педиатр. Вмятина. 2004. 28: 203–214. DOI: 10.17796 / jcpd.28.3.w0610427l746j34n. [PubMed] [CrossRef] [Google Scholar] 37. Hsu H., Huang G., Chang H., Hang Y., Guo M. Система непрерывного потока для оценки высвобождения / поглощения фторида реставрационными материалами, содержащими фтор. Вмятина. Матер. 2004. 20: 740–749. DOI: 10.1016 / j.dental.2003.10.008. [PubMed] [CrossRef] [Google Scholar] 38. Эль Маллак Б.Ф., Саркер Н.К. Выделение фторидов из стеклоиономерных цементов в деионизированной воде и искусственной слюне. Вмятина. Матер.1990; 6: 118–122. DOI: 10.1016 / S0109-5641 (05) 80041-7. [PubMed] [CrossRef] [Google Scholar] 39. Walls A.W.G. Стеклополиалкеноатные (стеклоиономерные) цементы: обзор. J. Dent. 1986; 14: 231–246. DOI: 10.1016 / 0300-5712 (86) -8. [PubMed] [CrossRef] [Google Scholar] 40. Creanor S.L., Carruthers L.M.C., Saunders W.P., Strang R., Foye R.H. Характеристики поглощения и высвобождения фторидов стеклоиономерными цементами. Caries Res. 1994; 28: 322–328. DOI: 10,1159 / 000261996. [PubMed] [CrossRef] [Google Scholar] 41. Гао В., Смалес Р.J. Высвобождение / поглощение фторидов из обычных и модифицированных смолами стеклоиономеров и компомеров. J. Dent. 2001; 29: 301–306. DOI: 10.1016 / S0300-5712 (00) 00053-1. [PubMed] [CrossRef] [Google Scholar] 42. Биллингтон Р.В., Хэдли П.С., Таулер М.Р., Пирсон Дж. Дж., Уильямс Дж. А. Влияние добавления ионов натрия и фторида к стеклоиономеру на его взаимодействие с раствором фторида натрия. Биоматериалы. 2000. 21: 377–383. DOI: 10.1016 / S0142-9612 (99) 00199-4. [PubMed] [CrossRef] [Google Scholar] 43. Чарнецкая Б., Николсон Дж.W. Созревание влияет на поглощение фторидов стеклоиономерными стоматологическими цементами. Вмятина. Матер. 2012; 28: e1 – e5. [PubMed] [Google Scholar] 44. Арбабзадек-Заваре Ф., Гиббс Т., Мейерс И.А., Бузари М., Мортазави С., Уолш Л.Дж. Схема перезарядки современных стеклоиономерных реставрационных материалов. Вмятина. Res. Дж. (Исфахан) 2012; 9: 139–145. DOI: 10.4103 / 1735-3327.95226. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 45. Маклин Дж. У., Уилсон А. Д. Герметизация и заполнение трещин клеевым стеклоиономерным цементом. Брит. Вмятина.J. 1974; 136: 269–276. DOI: 10.1038 / sj.bdj.4803174. [PubMed] [CrossRef] [Google Scholar] 46. Perondi P.R., Oliveira P.H.C., Cassoni A., Reis A.F., Rodrigues J.A. Предел прочности и микротвердости стеклоиономерных материалов. Braz. Вмятина. Sci. 2014; 17: 16–22. DOI: 10.14295 / bds.2014.v17i1.949. [CrossRef] [Google Scholar] 47. Powis D.R., Folleras T., Merson S.A., Wilson A.D. Улучшенная адгезия стеклоиономерного цемента к дентину и эмали. J. Dent. Res. 1982; 61: 1416–1422. DOI: 10.1177 / 00220345820610120801.[PubMed] [CrossRef] [Google Scholar] 48. Wilson A.D. Алюмо-силикатный цемент на основе полиакриловой кислоты. Брит. Polym. J. 1974; 6: 165–179. DOI: 10.1002 / pi.4980060303. [CrossRef] [Google Scholar] 49. Hien-Chi N., Mount G., McIntyre J., Tuisuva J., Von Doussa R.J. Химический обмен между стеклоиономерными реставрациями и остаточным кариозным дентином в постоянных молярах: исследование in vivo. J. Dent. 2006. 34: 608–613. [PubMed] [Google Scholar] 50. Бук Д. Улучшение адгезии полиакрилатных цементов к человеческому дентину.Брит. Вмятина. J. 1973; 135: 442–445. DOI: 10.1038 / sj.bdj.4803103. [PubMed] [CrossRef] [Google Scholar] 51. Ван Мирбек Б., Йошида Ю., Иноуэ С., Де Мунк Дж., Ван Ландуйт К., Ламбрехтс П. Адгезия стекло-иономера: механизмы на границе раздела. J. Dent. 2006; 34: 615–617. [Google Scholar] 52. Фукада Р., Йошида Ю., Накаяма Ю., Окадзаки М., Иноуэ С., Сано Х., Шинтани Х., Снауверт Дж., Ван Мербик Б. Эффективность связывания полиакеновых кислот с гидроксиапатитом, эмалью и дентином. Биоматериалы. 2003; 24: 1861–1867.DOI: 10.1016 / S0142-9612 (02) 00575-6. [PubMed] [CrossRef] [Google Scholar] 53. Йошида Ю., Ван Мирбек Б., Накаяма Ю., Снауварт Дж., Хеллманс Л., Ламбрехтс П., Ванхерле Г., Вакаса К. Доказательства химической связи на границах раздела биоматериал-твердая ткань. J. Dent. Res. 2000. 79: 709–714. DOI: 10.1177 / 002203450007
    301. [PubMed] [CrossRef] [Google Scholar] 54. Нго Х. Г., Маунт Дж. Дж., Питерс М. К. Р. Б. Исследование стеклоиономерного цемента и его границы раздела с эмалью и дентином с использованием низкотемпературной сканирующей электронной микроскопии с высоким разрешением.Quintessence Int. 1997. 28: 63–69. [PubMed] [Google Scholar] 55. Цю З.-Й., Но И.-С., Чжан С.-М. Силикатный гидроксиапатит и его стимулирующее действие на минерализацию костей. Фронт. Матер. Sci. 2013; 7: 40–50. DOI: 10.1007 / s11706-013-0193-9. [CrossRef] [Google Scholar] 56. Окада К., Тосаки С., Хирота К., Хьюм В.Р. Изменение твердости поверхности реставрационных пломбировочных материалов, хранящихся в слюне. Вмятина. Матер. 2001; 17: 34–39. DOI: 10.1016 / S0109-5641 (00) 00053-1. [PubMed] [CrossRef] [Google Scholar] 57. Ван Дуинен Р.Н.Б., Дэвидсон К.Л., де Джи А., Фейлцер А.Дж. Превращение стеклоиономера в эмалеподобный материал in situ. Являюсь. J. Dent. 2004. 17: 223–227. [PubMed] [Google Scholar] 58. Микенауч С., Маунт Дж. Дж., Йенгопал В. Терапевтический эффект стеклоиономеров: обзор доказательств. Aust. Вмятина. J. 2011; 56: 10–15. DOI: 10.1111 / j.1834-7819.2010.01304.x. [PubMed] [CrossRef] [Google Scholar] 59. Вайнтрауб Дж. А. Эффективность герметиков для ямок и фиссур. J. Public Health Dent. 1989; 49: 317–330. DOI: 10.1111 / j.1752-7325.1989.tb02090.x. [PubMed] [CrossRef] [Google Scholar] 60. Керванто-Сеппала С., Лавониус Э., Пиетила И., Питканиеми Дж., Меуман Дж. Х., Керосуо Э. Сравнение профилактического эффекта от кариеса двух методов герметизации фиссур в здравоохранении: однократное нанесение стеклоиономера и стандартной смолы -программа герметика. Рандомизированное клиническое исследование с разделенным ртом. Int. J. Paediatr. Вмятина. 2008; 18: 56–61. [PubMed] [Google Scholar] 61. Йенгопал В., Микенауиш С., Безерра А.С., Леал С.С. Профилактика кариеса стеклоиономерных герметиков на основе смол для фиссур на постоянные зубы: метаанализ.J. Oral Sci. 2009. 51: 373–382. DOI: 10.2334 / josnusd.51.373. [PubMed] [CrossRef] [Google Scholar] 62. Frencken J.E., Leal S.C., Navarro M.F. Подход к атравматическому восстановительному лечению (АРТ) в течение двадцати пяти лет: всесторонний обзор. Clin. Орал Инвест. 2012; 16: 1337–1346. DOI: 10.1007 / s00784-012-0783-4. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 63. Frencken J.E. Подход ART с использованием стеклоиономеров в отношении глобального ухода за полостью рта. Вмятина. Матер. 2010; 26: 1–6. DOI: 10.1016 / j.dental.2009.08.013. [PubMed] [CrossRef] [Google Scholar] 64. Smales R.J., Yip H.K. Атравматическое восстановительное лечение (ВРТ) для лечения кариеса зубов. Quintessence Int. 2002. 33: 427–432. [PubMed] [Google Scholar] 65. Митра С. Адгезия к дентину и физические свойства светоотверждаемого стеклоиономерного лайнера / основы. J. Dent. Res. 1991; 70: 72–74. DOI: 10.1177 / 00220345

    0011201. [PubMed] [CrossRef] [Google Scholar] 66. Берзиньш Д.В., Эбей С., Костач М.С., Уилки К.А., Робертс Х.В. Конкуренция реакции схватывания стеклоиономера, модифицированного смолой.J. Dent. Res. 2010; 89: 82–86. DOI: 10.1177 / 0022034509355919. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 67. Еламанчили А., Дарвелл Б.В. Сетевая конкуренция в стеклоиономерном цементе, модифицированном смолой. Вмятина. Матер. 2008. 24: 1065–1069. DOI: 10.1016 / j.dental.2007.12.005. [PubMed] [CrossRef] [Google Scholar] 68. Форсс Х. Высвобождение фторида и других элементов из стеклоиономеров светового отверждения в нейтральных и кислых условиях. J. Dent. Res. 1993; 72: 1257–1262. DOI: 10.1177 / 00220345930720081601. [PubMed] [CrossRef] [Google Scholar] 69.Чарнецка Б., Николсон Дж. В. Высвобождение ионов модифицированными смолами стеклоиономерными цементами в воду и растворы молочной кислоты. J. Dent. 2006; 34: 539–543. DOI: 10.1016 / j.jdent.2005.08.007. [PubMed] [CrossRef] [Google Scholar] 70. Палмер Г., Анстис Х.М., Пирсон Г.Дж. Влияние режима отверждения на высвобождение гидроксэтилметацилата (ГЭМА) из модифицированных смолой стеклоиономерных цементов. J. Dent. 1999. 27: 303–311. DOI: 10.1016 / S0300-5712 (98) 00058-X. [PubMed] [CrossRef] [Google Scholar] 71. Хамид А., Хьюм В.Р. Диффузия мономеров смолы через кариозный дентин человека in vitro.Эндод. Вмятина. Traumatol. 1997; 13: 1–5. DOI: 10.1111 / j.1600-9657.1997.tb00001.x. [PubMed] [CrossRef] [Google Scholar] 72. Кан К.С., Мессер Л.Б., Мессер Х.Х. Изменчивость цитотоксичности и высвобождения фторидов стеклоиономерных цементов, модифицированных смолой. J. Dent. Res. 1997. 76: 1502–1507. DOI: 10.1177 / 00220345970760081301. [PubMed] [CrossRef] [Google Scholar] 73. Канерва Л., Йоланки Р., Лейно Т., Эстландер Т. Профессиональный аллергический контактный дерматит от 2-гидроксэтилметакрилата и диметакрилата этиленгликоля в модифицированном акриловом структурном адгезиве.Свяжитесь с Dermat. 1995; 33: 84–89. DOI: 10.1111 / j.1600-0536.1995.tb00506.x. [PubMed] [CrossRef] [Google Scholar] 74. Николсон Дж. В., Чарнецка Б. Биосовместимость модифицированных смолами стеклоиономерных цементов для стоматологии. Вмятина. Матер. 2008. 24: 1702–1708. DOI: 10.1016 / j.dental.2008.04.005. [PubMed] [CrossRef] [Google Scholar] 75. Сидху С.К. Клиническая оценка реставраций из стеклоиономерного полимера. Вмятина. Матер. 2010; 26: 7–12. DOI: 10.1016 / j.dental.2009.08.015. [PubMed] [CrossRef] [Google Scholar] 76.Smales R.J., Wong K.C. Двухлетние клинические испытания стеклоиономерного герметика, модифицированного смолой. Являюсь. J. Dent. 1999; 12: 62–64. [PubMed] [Google Scholar] 77. Pameijer C.H. Удержание коронки с помощью трех стеклоиономерных цементов, модифицированных смолой. Варенье. Вмятина. Доц. 2012; 143: 1218–1222. DOI: 10.14219 / jada.archive.2012.0067. [PubMed] [CrossRef] [Google Scholar] 78. Зайнуддин Н., Карпухина Н., Хилл Р.Г., Ло Р.В. Определение характеристик реминерализующего иономерного цемента Glass Carbomer ® методом MAS-ЯМР-спектроскопии.Вмятина. Матер. 2012; 28: 1051–1058. [PubMed] [Google Scholar] 79. Чехрели С.Б., Тирали Р.Э., Ялчинкава З., Чехрели З.С. Микроподтекание недавно разработанного стеклянного карбомерного цемента в молочных зубах. Евро. J. Dent. 2013; 7: 15–21. [Бесплатная статья PMC] [PubMed] [Google Scholar]

    80. Van Duinen W., Van Duinen R.N. Самозатвердевающий стекломерный карбомерный состав. 20060217455 A1. Патент США. 2004

Salt Асимметричное растяжение C – O (см −1 ) Симметричное растяжение C – O (см −1 )
Calcium1410 11 9011
Полиакрилат алюминия 1559 1460
Тартрат кальция 1595 1385
Тартрат алюминия 1670 1410 906 в целом действие кислоты (в т.ч. в стеклоиономерном цементе задерживается схватывание, поэтому цемент легче перемешивается.Затем он резко затвердевает, чтобы получить законченный затвердевший материал, который можно обработать внутри зуба. Вследствие способности способствовать этим изменениям (+) - винная кислота является очень полезной добавкой. Однако его эффективность зависит от стакана и зависит от его состава.

6. Отверждение стеклоиономерных цементов

Стеклоиономеры затвердевают в течение 2–3 минут после смешивания путем кислотно-щелочной реакции. Первая стадия - это реакция с гидратированными протонами поликислоты на основных участках поверхности стеклянных частиц.Это приводит к перемещению ионов, таких как Na + и Ca 2+ (или Sr 2+ ) из стекла в раствор поликислот, за которым быстро следуют ионы Al 3+ . Затем эти ионы взаимодействуют с молекулами поликислоты с образованием ионных поперечных связей, и образующаяся нерастворимая полисоль становится жестким каркасом для затвердевшего цемента. Когда происходит эта реакция схватывания, вся вода включается в цемент, и разделения фаз не происходит.

Отверждение стеклоиономерных цементов было изучено с помощью различных спектроскопических методов, включая инфракрасную, ИК-Фурье спектроскопию и спектроскопию ЯМР 13 C.Общая реакция, по-видимому, происходит в два этапа в процессе, контролируемом диффузией [18]. Как мы видели, первым шагом является образование ионных сшивок, и это отвечает за немедленный процесс отверждения. Впоследствии происходит процесс сшивания с участием ионов Al 3+ , который занимает около 10 минут, чтобы быть четко идентифицированным спектроскопически [19]. Этот второй шаг медленный и продолжается примерно день [20].

После этого начального затвердевания идут дальнейшие реакции, которые протекают медленно и вместе известны как созревание.Они связаны с различными изменениями физических свойств получаемого стеклоиономерного цемента [1]. Как правило, увеличивается сила и полупрозрачность. Кроме того, в конструкции увеличивается доля плотно связанной воды. Детали этих процессов неизвестны, и исследования по этому вопросу продолжаются.

Несколько лет назад было показано, что твердые нерастворимые цементы могут быть образованы реакцией иономерных стекол с уксусной кислотой. И это несмотря на то, что соли ацетатов металлов растворимы в воде [21].Также было замечено, что эти цементы становились все более прочными при сжатии до 3 месяцев, хотя не было заметных изменений в инфракрасных спектрах цементов. Это привело к выводу, что существует неорганическая реакция схватывания, которая дополняет реакцию нейтрализации при схватывании этих цементов. Силикаты металлов были предложены в качестве веществ, ответственных за эту установку [21], но последующая работа над тем, что стало называться «псевдоцементами» (т.е. цементами, изготовленными из мономерных кислот с иономерными стеклами), показала, что нерастворимые материалы получаются только с фосфатными стеклами.Напротив, силикатные стекла, не содержащие фосфатов, не подвергаются эквивалентной реакции схватывания [22]. Это говорит о том, что предлагаемая неорганическая сетка имеет фосфатную основу.

7. Роль воды

Как уже упоминалось, вода является третьим важным компонентом стеклоиономерного цемента. Для воды было определено несколько ролей [9]. Это растворитель для полимерной кислоты, он позволяет полимеру действовать как кислота, способствуя высвобождению протонов, это среда, в которой происходит реакция схватывания, и, наконец, он является компонентом затвердевшего цемента [9].

Включение воды со стеклоиономерами связано с увеличением прозрачности стеклоиономерного цемента. Доля плотно связанной воды увеличивается со временем в течение первого месяца или около того существования цемента, и было предложено несколько возможных участков. Связывание может происходить частично за счет координации с ионами металлов и частично за счет сильной гидратации молекул полианионов [9]. Кроме того, он может реагировать с звеньями –Si – O – Si– на поверхности частиц стекла, что приводит к образованию групп –Si – OH [23].Это было подтверждено несколькими исследованиями FTIR, в которых изучалась соответствующая область спектра. Эти исследования показали наличие изменений, согласующихся с уменьшением доли групп –Si – O – Si– (о чем свидетельствует уменьшение интенсивности полосы при 1060 см –1 ) и увеличение пиков, обусловленных –Si –OH (силанол) (один при 950 см −1 [24] и один в области 3435–3445 см −1 [8]).

Несвязанная вода может улетучиваться с поверхности свежеуложенного стеклоиономерного цемента.Это приводит к появлению некрасивого мелового цвета, поскольку на высыхающей поверхности появляются микроскопические трещины. Чтобы предотвратить это, важно защитить цемент, покрыв его соответствующим лаком или вазелином [25].

Доступны два типа лака: простой раствор полимера в растворителе и светоотверждаемый мономер с низкой вязкостью. Имеются данные о том, что светоотверждаемые лаки обеспечивают превосходную защиту от высыхания [25], поскольку отсутствие растворителя означает, что образованная пленка не имеет пористости, через которую может выходить вода.

8. Свойства стеклоиономеров

На физические свойства стеклоиономерных цементов влияет способ приготовления цемента, включая его соотношение порошок: жидкость, концентрацию поликислоты, размер частиц стеклянного порошка и возраст экземпляров. Поэтому необходимо с осторожностью делать обобщения относительно свойств этих материалов. Существует также вероятность того, что часть успеха стеклоиономеров может быть связана с их удовлетворительными характеристиками, даже если они не были должным образом смешаны или не были допущены к созреванию в идеальных условиях.

Текущий стандарт ISO для стеклоиономеров [3] дает минимальные значения для определенных физических свойств. Эти значения, показанные в, являются наименее приемлемыми для материала, который может быть допущен на рынок, а не типичными для материалов, которые, как известно, обладают хорошими клиническими показателями.

Таблица 3

Требования ISO к стеклоиономерным цементам клинического качества.

Свойство Фиксирующий цемент Восстановительный цемент
Время схватывания / мин 2.5–8 2–6
Прочность на сжатие / МПа 70 (минимум) 100 (минимум)
Кислотная эрозия (максимальная) / мм ч -1 - 906 0,05
Непрозрачность, C 0,70 - 0,35–0,90
Кислоторастворимый As / мг кг -1 2 2 2 Pb / мг кг −1 100 100

Единственный тип прочности, о котором идет речь в стандарте ISO, - это прочность на сжатие, но стеклоиономеры также обладают приемлемой прочностью на изгиб [1].Их двухосный изгиб [26] и их прочность на сдвиг [27] также были определены. Как и ожидалось, для композитного материала они демонстрируют те же тенденции, что и прочность на сжатие, обычно улучшаясь при более высоких соотношениях порошок: жидкость и высокой концентрации поликислоты.

9. Выделение фторидов

Выделение фторидов считается одним из важных преимуществ стеклоиономерных цементов [1]. Он может поддерживаться в течение очень длительных периодов времени [28] и демонстрирует образец начального быстрого высвобождения («ранний всплеск»), за которым следует устойчивое высвобождение, основанное на диффузии более низкого уровня [29].Эти процессы следуют схеме, описанной уравнением [30]:

[ F ] c = ([ F ] 1 × √ t ) / ( t + t 1/2 ) + β · √ t

(1)

В этом уравнении [ F ] c - кумулятивное высвобождение фторида за время t секунд, [ F ] 1 - общий доступный фторид, t - время и t 1/2 - время, необходимое для того, чтобы высвобождение фторида снизилось вдвое, так называемый период полураспада процесса высвобождения.Начальный член ([ F ] 1 × √ t ) / ( t + t 1/2 ) представляет собой фазу «раннего всплеска», хотя было установлено, что она продолжается на срок до четырех недель. Второй член β · √ t в этом уравнении представляет собой долгосрочную диффузионную часть процесса высвобождения.

Выделение фторида из стеклоиономеров увеличивается в кислой среде [31]. Кроме того, эти цементы способны противодействовать такой кислотности, повышая pH внешней среды.Этот процесс получил название буферизации и может быть клинически полезным, поскольку может защитить зуб от дальнейшего разрушения [31].

Высвобождение фторида в кислой среде происходит при комплексообразовании. Это могут быть ионы алюминия, которые высвобождаются в больших количествах, чем в нейтральных условиях, или ионы водорода. Первые могут приводить к образованию таких видов, как AlF4– [32], а вторые могут вызывать образование либо комплекса HF2–, либо недиссоциированного HF [33]. Ни один из этих возможных видов фторидов не дает свободных ионов фтора, поэтому они не обнаруживаются селективными электродами для фторид-иона.Следовательно, фторид должен быть разложен с образованием свободных ионов F - путем добавления TISAB (буфера для регулирования общей ионной растворимости). Это запатентованное решение, поставляемое различными производителями с целью разложения фторида и обеспечения того, чтобы весь фторид в пробе присутствовал в виде свободных анионов.

Было показано, что гидроксиапатит взаимодействует с кислотными носителями из стеклоиономерных цементов с поглощением фторида, независимо от того, образует ли фторид комплекс с какими-либо другими химическими соединениями [34].Эти данные предполагают, что повышенное количество фторидов, выделяемых стеклоиономерами в кислых условиях, увеличит количество фторида, доставляемого в минеральную фазу зуба [34].

Высвобождение фторида обычно считается клинически полезным. Однако убедительных доказательств этого пока нет. Известно, что постоянная подача низких уровней фторида к твердым тканям зуба полезна [35], причем концентрации на уровне миллионных долей достаточны для подавления деминерализации дентина в измеримых количествах [36].Выделение фторида может также снизить гиперчувствительность твердых тканей к холодной пище и напиткам. Такое количество фторида кажется достижимым из стеклоиономерных цементов [37], но они не были продемонстрированы в течение длительного времени в слюне. На сегодняшний день выделение в основном изучается в чистой воде, а при использовании искусственной слюны наблюдаются гораздо более низкие уровни выделения [38]. Из-за этого вероятное клиническое высвобождение в слюну в долгосрочной перспективе неизвестно.

Фторид также поглощается стеклоиономерными цементами, по крайней мере, на ранних стадиях существования цемента.Первоначально это было предложено Уоллсом [39], и ранние эксперименты, в которых выделение из цемента, хранящегося в воде, сравнивали с выделением из цемента, хранящегося в растворе фторида, подтвердили эту идею [40,41]. Было показано, что даже бесфторидные стеклоиономеры, подвергшиеся воздействию фторида, при такой обработке становятся высвобождающими фтор [42].

Прямые измерения подтверждают, что эти цементы поглощают фторид [43]. Однако было обнаружено, что эта способность почти полностью утрачивается при созревании, поэтому месячные экземпляры Ketac Molar Quick (3M ESPE, Сент-Пол, Миннесота, США) и Fuji IX Fast (GC, Токио, Япония) не использовали любой измеримый фторид вообще [43].Эти результаты предполагают, что пополнение запасов фтора снижается по мере созревания и что это более сложно, чем предполагают многие отчеты [44]. В сообщениях, возможно, в любом случае преувеличивалась его потенциальная важность, потому что условия с высоким содержанием фтора, при которых может происходить перезарядка стеклоиономерной реставрации, также заставят соседний минерал зуба поглощать фторид. Таким образом, будет обеспечена защита от кариеса независимо от усиленного выделения фторида из цемента.

10. Адгезия

Адгезия стеклоиономеров к поверхности зуба является важным клиническим преимуществом.Стеклоиономеры получают из поли (акриловой кислоты) или родственных полимеров, и это вещество, как известно, способствует адгезии из-за адгезии поликарбоксилатного цемента цинка [9]. Преимущество, обеспечиваемое их адгезией, было использовано много лет назад, когда стеклоиономеры были предложены для восстановления эрозии шейки матки и в качестве герметиков для ямок и фиссур [45].

Прочность сцепления при растяжении стеклоиономеров с необработанной эмалью и дентином хорошая [46]. Значения на эмали варьируются от 2.От 6 до 9,6 МПа, а значения на дентине варьируются от 1,1 до 4,1 МПа. Прочность связи обычно выше с эмалью, чем с дентином, что позволяет предположить, что связь имеет место с минеральной фазой [47]. Прочность связи развивается быстро, около 80% конечной прочности связи достигается за 15 минут, после чего она увеличивается на несколько дней [47].

Адгезия проходит в несколько этапов. Во-первых, нанесение свежей цементной пасты позволяет правильно смачивать поверхность зуба.Это обусловлено гидрофильной природой как цемента, так и поверхности зуба. Затем быстро развивается адгезия из-за образования водородных связей между свободными карбоксильными группами цемента и связанной водой на поверхности зуба [48]. Эти водородные связи медленно заменяются истинными ионными связями, образованными между катионами в зубе и анионными функциональными группами в цементе. Это приводит к медленному образованию ионообменного слоя между зубом и цементом [49]. Также существует возможность прочных связей между карбоксилатными группами поли (акриловой кислоты) и поверхностью, как показывает инфракрасная спектроскопия [50].Коллаген, по-видимому, вообще не участвует в связывании [50].

В клинике поверхность зуба подготавливается к бондингу путем кондиционирования - процесса, который включает обработку поверхности свежесрезанного зуба 37% водным раствором поли (акриловой кислоты) в течение 10–20 с с последующим промыванием [47] . Эта техника удаляет смазанный слой и открывает дентинные канальцы, а также частично деминерализует поверхность зуба. Это приводит к увеличению площади поверхности и позволяет возникать микромеханическое прикрепление [51].

Таким образом, в целом адгезию стеклоиономерных цементов можно отнести к двум взаимосвязанным явлениям, а именно:

  1. Микромеханическая блокировка, вызванная самотравлением стеклоиономеров за счет поликислотного компонента.

  2. Истинная химическая связь. При этом образуются ионные связи между карбоксилатными группами на молекулах поликислот и ионами кальция на поверхности зубов [51]. Это наблюдалось экспериментально на гидроксиапатите [52], а также на эмали и дентине [53] с помощью рентгеновской фотоэлектронной спектроскопии, хотя экспериментальные условия для этих исследований включают высокий вакуум, поэтому требуется, чтобы поверхности были более сильно высушены, чем в клинических условиях. .

В долгосрочной перспективе происходит процесс диффузии, в котором ионы из цемента и ионы из зуба перемещаются в межфазную зону и создают ионообменный слой () [54]. Этот слой можно увидеть с помощью сканирующей электронной микроскопии. На изображении использовался стеклоиономерный цемент на основе стронция Fuji IX (GC, Токио, Япония), и анализ показал, что межфазная зона содержала как стронций, так и кальций, что указывает на то, что эта зона является результатом движения ионов как от цемента, так и от зуб.Полученная структура обеспечивает прочное сцепление цемента и зуба.

Межфазный ионообменный слой, образованный между поверхностью зуба (вверху) и стеклоиономерным цементом (внизу). Кружком обозначена часть ионообменного слоя.

Исследования показывают, что разрушение стеклоиономерного цемента обычно является когезионным, то есть происходит внутри цемента, а не на границе раздела. В результате значения сцепления, полученные в ходе экспериментов, на самом деле являются мерой не прочности сцепления, а прочности цемента на разрыв.Эта прочность относительно низкая в свежеприготовленных образцах, но увеличивается по мере созревания цемента. Следствием этого является то, что приведенные в литературе значения не являются истинными показателями прочности адгезионного соединения стеклоиономерных цементов.

Адгезия важна, потому что она помогает удерживать стеклоиономерный цемент внутри зуба, а также снижает или устраняет незначительную утечку. Это означает, что вредные микроорганизмы не могут проникнуть в пространство под реставрацией и вызвать гниение.

11. Биоактивность

Стеклоиономерные цементы обладают естественной биологической активностью, отчасти потому, что они выделяют биологически активные ионы (фторид, натрий, фосфат и силикат) в окружающие водные среды на уровнях, при которых они являются биологически полезными [31]. В кислых условиях эти ионы выделяются в больших количествах, чем в нейтральных условиях. Кроме того, также выделяются кальций или стронций, ионы, которые встречаются в относительно нерастворимых соединениях в нейтральных растворах. В кислых условиях стеклоиономеры также снижают pH окружающей среды для хранения [31].

Высвободившиеся ионы выполняют различные биологические функции. Фосфат содержится в слюне и находится в равновесии с минеральной фазой зуба. Силикат может включаться в гидроксиапатит зуба, не влияя отрицательно на геометрию кристалла [55], хотя неясно, может ли он это сделать с минеральной фазой зубов в клинических условиях. Кальций - важный минеральный элемент, имеющий множество биологических применений. Во рту он является основным противоионом гидроксиапатита, и в растворе в умеренно кислых условиях способствует реминерализации зуба.

Как мы видели в связи с адгезией, способность обмениваться ионами с окружающей средой также применима к твердому зубу. Со временем образуется богатый ионами слой, очень устойчивый к воздействию кислоты. Следовательно, вторичный кариес вокруг стеклоиономерных реставраций наблюдается редко.

Стеклоиономеры также способны поглощать ионы. В естественной слюне цемент поглощает ионы кальция и фосфата и образует гораздо более твердую поверхность [56]. С этим связано наблюдение, что при использовании в качестве герметиков для фиссур стеклоиономерные цементы образуют глубоко внутри трещин вещество, которое имеет повышенное содержание кальция и фосфата и гораздо более устойчиво к резанию стоматологическим сверлом, чем исходная структура зуба. .Утверждается, что это улучшенное сопротивление высверливанию, а также изменение внешнего вида делают остаточный материал похожим на эмаль [57].

12. Клиническое применение стеклоиономерных цементов

Стеклоиономеры находят различное применение в стоматологии. Они используются в качестве полных реставрационных материалов, особенно в молочных зубах, а также в качестве подкладок и базисов, в качестве герметиков для фиссур и в качестве связующего вещества для ортодонтических скоб. Их можно разделить на три типа, в зависимости от предполагаемого клинического использования, а именно:

Тип I. Фиксирующие и связывающие цементы.

  • Для фиксации коронок, мостов, вкладок, накладок и ортодонтических аппаратов.

  • Используйте относительно низкое соотношение порошок: жидкость (от 1,5: 1 до 3,8: 1), что дает только умеренную прочность.

  • Быстро схватывается с хорошей ранней водостойкостью.

  • Рентгеноконтрастные.

Тип II: Восстановительные цементы.

Есть два подразделения цементов типа II, в зависимости от важности внешнего вида.

Для ремонта передней части, когда внешний вид имеет значение, Тип II (i):

  • Используйте высокое соотношение порошок: жидкость (от 3: 1 до 6,8: 1).

  • Хорошая цветопередача и прозрачность.

  • Требуется защита от влаги не менее 24 часов с помощью лака или вазелина.

  • Обычно рентгеноконтрастные.

Для использования там, где внешний вид не важен (реставрация или ремонт боковых зубов), тип II (ii):

Тип III: Футеровочный или основной цемент

  • Низкое соотношение порошок: жидкость для лайнеров (1.5: 1), чтобы обеспечить хорошее прилегание к стенкам полости.

  • Более высокое соотношение порошок: жидкость для основ (от 3: 1 до 6,8: 1), где основа действует как заменитель дентина в технике «открытого сэндвича» в сочетании с композитной смолой.

  • Рентгеноконтрастный.

Большая часть работ, посвященных клинической эффективности стеклоиономеров, носила анекдотический характер, и решения о клиническом применении основывались на суждениях и опыте клиницистов.Недавние попытки проанализировать все опубликованные данные подтвердили, что стеклоиономеры действительно обладают измеримым противокариесным эффектом. Однако на сегодняшний день менее ясны данные о том, полезно ли их высвобождение фторидов на практике [58].

13. Герметики для трещин

Герметики различных типов помещаются в трещины коренных или постоянных коренных зубов, чтобы предотвратить развитие кариеса, предотвращая колонизацию трещин зубным налетом и пленкой [59]. Стекло-иономер был предложен для этого еще в 1974 г. [46].

С тех пор было проведено множество исследований для сравнения эффективности стеклоиономерных цементов и композитных герметиков на основе смол. Обычно они определили относительную степень удерживания и в основном обнаружили, что стеклоиономеры уступают в этом отношении [60]. Однако, если принять во внимание скорость кариеса, стеклоиономеры оказываются столь же эффективными или превосходящими композитные смолы [61]. Это может быть связано с удерживанием цемента глубоко внутри трещины, а также с антикариесным действием фторида, выделяемого цементом [1].

Стеклоиономеры имеют определенные преимущества перед композитами в качестве герметиков для трещин, в частности, они гидрофильны и стабильны по размеру. Будучи гидрофильными, они могут впитывать любую жидкость, оставшуюся на дне трещины, и при этом прилипать к эмали. Стабильность размеров позволяет цементу сохранять свою граничную адаптацию и плотно прилегать к зубу. В результате исключается риск развития кариеса под герметизирующим материалом фиссур.

Совсем недавно в результате разработки стеклоиономеров с высокой вязкостью был получен материал, который дает гораздо лучшие показатели удерживания [61], и теперь они хорошо сравниваются с композитными герметиками.Поэтому их использование для герметизации фиссур, вероятно, будет продолжаться и в будущем.

14. Методика атравматического реставрационного лечения (ВРТ)

Стеклоиономеры - это материалы, используемые для восстановления зубов методом ВРТ [62]. Методика была разработана под эгидой Всемирной организации здравоохранения с целью оказания стоматологической помощи в странах с низким и средним уровнем доходов. В этих странах не лечат кариес должным образом, а зубную боль лечат путем удаления пораженного зуба.Кроме того, в этих странах обычно используются ненадежные или отсутствующие источники электропитания, а это означает, что электрические сверла и боры не могут использоваться в обычном порядке.

Для решения этих проблем было разработано и внедрено ART в различных странах по всему миру. ART использует ручные инструменты для удаления дентина и эмали, пораженных кариесом, после чего на зуб помещается стеклоиономерный цемент высокой вязкости [63]. Стеклоиономерный цемент используется потому, что он адгезивный и может использоваться на поверхностях зубов, которые прошли минимальную подготовку.

Сообщается, что АРТ является успешным, особенно при одноповерхностных поражениях. Например, в постоянных зубах после 2–3 лет реставрации классов I и V были успешны около 90% [64]. АРТ назначают детям, которые обычно с готовностью принимают лечение [62]. Этот метод оказался успешным в оказании стоматологической помощи людям, которым в противном случае оказывалась бы минимальная помощь или ее не было бы вообще, и которым в противном случае пришлось бы удалить несколько зубов [62].

15. Модифицированные смолой стеклоиономеры

Эти материалы были представлены стоматологам в 1991 г. [65].Они содержат те же основные компоненты, что и обычные стеклоиономеры (основной стеклянный порошок, вода, поликислоты), но также включают мономерный компонент и связанную с ним систему инициатора. Мономером обычно является 2-гидроксиэтилметакрилат, HEMA (), а инициатором является камфорхинон [65]. Модифицированные смолой стеклоиономеры устанавливаются двойными процессами нейтрализации (кислотно-основная реакция) и аддитивной полимеризации, и получаемый материал имеет сложную структуру, основанную на комбинированных продуктах этих двух реакций [66].Более того, конкуренция между этими двумя реакциями формирования сети означает, что между ними существует чувствительный баланс [67]. Такое сочетание реакций схватывания может поставить под угрозу надежность затвердевшего материала, и, как следствие, строгое соблюдение рекомендаций производителя относительно продолжительности этапа облучения является важным для получения материала с оптимальными свойствами [67].

2-гидроксиэтилметакрилат (HEMA).

Стекла, используемые в стеклоиономерах, модифицированных смолой, аналогичны стеклам, используемым в обычных стеклоиономерах.Кислый полимер тоже может быть таким же, хотя в некоторых материалах он модифицирован боковыми цепями, заканчивающимися ненасыщенными винильными группами. Они могут участвовать в реакции аддитивной полимеризации и образовывать ковалентные поперечные связи между полимерными цепями.

По физическим свойствам стеклоиономеры, модифицированные смолой, сопоставимы со свойствами обычных стеклоиономеров [66]. Они также выделяют фторид в двухстадийном процессе, который идентичен таковому для обычных стеклоиономеров в том, что есть ранняя фаза вымывания, за которой следует длительная фаза, основанная на диффузии [29].Кинетическое уравнение, описывающее этот процесс, точно такое же, как и уравнение для обычных стеклоиономеров [29,30].

Как и обычные стеклоиономерные цементы, модифицированные смолой стеклоиономеры выделяют небольшие количества натрия, алюминия, фосфата и силиката в нейтральных условиях [68] В кислых условиях выделяются большие количества, а также выделяется кальций (или стронций). [68]. Высвобождение ионов в кислых условиях связано с буферным эффектом, т.е. pH среды для хранения постепенно увеличивается с увеличением времени хранения [69].

Биосовместимость стеклоиономеров, модифицированных смолами, значительно снижена по сравнению с обычными стеклоиономерами. Это происходит из-за высвобождения мономера HEMA, который выщелачивается из модифицированных смолой стеклоиономеров в различных количествах, главным образом в первые 24 часа [70]. Высвобождаемое количество зависит от степени светового отверждения цемента [70]. HEMA может диффундировать через дентин человека [71] и цитотоксичен для клеток пульпы [72].

ГЭМА из стеклоиономеров, модифицированных смолой, также может вызвать проблемы для стоматологического персонала, поскольку он является контактным аллергеном и летучим, поэтому его можно вдыхать [73].Для обеспечения безопасного использования этих материалов клиницистам рекомендуется использовать хорошо вентилируемое рабочее место и избегать вдыхания паров [74]. Им также рекомендуется обработать светом любые неиспользованные остатки материала перед утилизацией. Несмотря на эти опасения, похоже, что в литературе нет тематических исследований или сообщений о побочных реакциях пациентов или стоматологического персонала на модифицированные смолой стеклоиономеры, хотя есть некоторые неофициальные данные о развитии аллергии в последней группе.

Стеклоиономеры, модифицированные смолой, имеют такое же клиническое применение, как и обычные стеклоиономеры [75], хотя они не рекомендуются для техники ART из-за необходимости использования полимеризационных ламп с электрическим приводом.Таким образом, они используются в реставрациях Класса I, Класса II и Класса III, все в основном в первичных зубных рядах, реставрациях Класса V, а также в качестве вкладышей и базисов [76]. Другие области применения включают в себя герметики фиссур [76] и связующие вещества для ортодонтических скоб [77].

16. Стекло-карбомер

®

Это новый коммерческий материал стеклоиономерного типа, который имеет повышенную биоактивность по сравнению с обычным стеклоиономерным цементом. Производится компанией GCP Dental в Нидерландах.Название «стеклянный карбомер» было принято в научной литературе [77,78], что прискорбно, потому что это торговая марка, а материал на самом деле является разновидностью стеклоиономера. Он устанавливается в результате кислотно-щелочной реакции между водной полимерной кислотой и выщелачиваемым ионами основным стеклом, хотя он также содержит вещества, которые обычно не входят в состав стеклоиономеров [79].

Это следующие компоненты:

  • Стеклянный порошок, промытый сильной кислотой, так что поверхностные слои частиц существенно обеднены кальцием [80].Следовательно, большая часть ионов кальция находится внутри частиц по направлению к сердцевине.

  • Силиконовое масло, содержащее полидиметилсилоксан, как правило, линейной структуры, который содержит гидроксильные группы. Это позволяет силиконовому маслу образовывать водородные связи с другими компонентами цемента, так что оно остается связанным в цементе после схватывания.

  • Биоактивный компонент, который также действует как вторичный наполнитель. Спектроскопия ЯМР твердого тела показала, что этот наполнитель на самом деле является гидроксиапатитом [78], и он включен для ускорения образования эмалеподобного материала на границе с зубом, как это наблюдалось ранее с обычными стеклоиономерными герметиками для фиссур.

Стекло, используемое в стеклянном карбомере, содержит стронций, а также большое количество кремния [78], а также небольшое количество кальция. В нем относительно много кремния по сравнению со стеклами, используемыми в известных марках стеклоиономеров Fuji IX и Ketac Molar, но они содержат сопоставимые количества алюминия, фосфора и фторида.

Из-за процесса кислотной промывки стекло практически не реагирует с поли (акриловой кислотой) или сополимером акриловой / малеиновой кислоты.Кроме того, силиконовое масло, включенное в стеклянный порошок, адсорбируется на поверхности стекла, что также препятствует реакции с поликислотой. В результате стеклянный карбомер легко смешивать при высоких соотношениях порошок: жидкость, и при смешивании этих двух компонентов происходит лишь небольшая реакция.

После смешивания материала его медленная реакция схватывания ускоряется за счет применения стоматологической лампы для отверждения в течение не менее 20 секунд [79]. Это не способствует фотополимеризации, а потому, что стоматологические лампы выделяют тепло.Это увеличивает температуру цемента, что приводит к его схватыванию за разумное время.

Стеклянные карбомеры содержат большое количество стекла по сравнению с обычными стеклоиономерами, а также гидроксиапатитовый наполнитель, так что застывший стеклянный карбомер будет очень хрупким. Чтобы преодолеть это, добавляют силиконовое масло. Как мы видели, он делает материал жестким и остается связанным в нем водородными связями.

Исследования реакции схватывания показывают, что схватывание стеклянного карбомера включает две параллельные реакции, одна с участием стекла и поликислоты, а другая - гидроксиапатита и поликислоты.Обе реакции являются кислотно-основными и приводят к матрице поликислот, сшитой ионным путем, содержащей внедренный наполнитель. Однако в этом случае наполнителем является не только стекло с обедненными ионами, но также частично прореагировавший гидроксиапатит. Полученная матрица аналогична той, которая встречается в обычном стеклоиономерном цементе, но отличается тем, что она также включает полидиметилсилоксановое масло [80].

На сегодняшний день имеются только предварительные отчеты об использовании стеклянного карбомера в клинических условиях, а долгосрочные исследования не опубликованы.Следовательно, долговечность материала во рту пациентов еще не известна.

17. Выводы

Этот обзор показал из опубликованной литературы, что стеклоиономерные цементы являются универсальными кислотно-щелочными материалами, которые находят множество применений в современной стоматологии. Они проявляют определенную степень биоактивности при установке, что заставляет их образовывать межфазный ионообменный слой с зубом, и это отвечает за высокую прочность их адгезии к поверхности зуба. Они выделяют фтор в течение значительных периодов времени, что обычно считается полезным, хотя доказательства в поддержку этого несколько сомнительны.

Доступны модифицированные формы стеклоиономеров в виде стеклоиономеров, модифицированных смолой, и стеклянного карбомера. Первые включают мономер и частично устанавливаются аддитивной полимеризацией, которая усиливает кислотно-основной процесс и может контролироваться с помощью световой активации. По физическим свойствам эти материалы сравнимы с обычными стеклоиономерами, но их биосовместимость хуже. Стеклянный карбомер оказывается более хрупким и менее прочным, чем лучшие современные стеклоиономеры.Он высвобождает фторид, и в литературе утверждается, что он был разработан с целью повышения его биологической активности [78,80], хотя до сих пор доказательства, подтверждающие это, отсутствуют.

Благодарности

Этот обзор был написан без внешнего финансирования, а расходы на публикацию были покрыты Bluefield Center for Biomaterials Co Ltd, Лондон, Великобритания.

Вклад авторов

Авторство ограничено теми, кто внес существенный вклад в работу статьи.Работа была спланирована совместно с J.W.N. взял на себя основное написание, а С.К.С. предоставил исправления и клиническое понимание.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Ссылки

1. Mount G.J. Цветовой атлас стеклоиономерного цемента. 2-е изд. Мартин Дуниц; Лондон, Великобритания: 2002. [Google Scholar] 2. Уилсон А.Д., Кент Б.Е. Стеклоиономерный цемент, новый светопрозрачный цемент для стоматологии. J. Appl. Chem. Biotechnol. 1971; 21: 313. DOI: 10.1002 / jctb.5020211101. [CrossRef] [Google Scholar] 3. ISO 9917–1: Цементы на водной основе для стоматологии. Международная Организация Стандартизации; Женева, Швейцария: 2003. [Google Scholar] 4. Маклин Дж. У., Николсон Дж., Уилсон А. Д. Гостевая редакция: Предлагаемая номенклатура стеклоиономерных стоматологических цементов и родственных материалов. Quintessence Int. 1994; 25: 587–589. [PubMed] [Google Scholar] 5. Эллис Дж., Уилсон А.Д. Полифосфонатные цементы: новый класс стоматологических материалов. J. Mater. Sci. Lett. 1990; 9: 1058–1060. DOI: 10.1007 / BF00727876. [CrossRef] [Google Scholar] 6. Николсон Дж. Стеклоиономерные цементы для клинической стоматологии. Матер. Technol. 2010; 25: 8–13. DOI: 10,1179 / 175355509X12614966220506. [CrossRef] [Google Scholar] 7. Крисп С., Кент Б.Э., Льюис Б.Г., Фернер А.Дж., Уилсон А.Д. Составы стеклоиономерного цемента. II. Синтез новых поликарбоновых кислот. J. Dent. Res. 1980; 59: 1055–1063. DOI: 10.1177 / 002203458005801. [PubMed] [CrossRef] [Google Scholar] 8. Фарид М.А., Стамбулис А. Добавка наноглины к обычным стеклоиономерным цементам: влияние на свойства.Евро. Вмятина. J. 2014; 8: 456–463. DOI: 10.4103 / 1305-7456.143619. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Николсон Дж. Химия стеклоиономерных цементов: обзор. Биоматериалы. 1998. 6: 485–494. DOI: 10.1016 / S0142-9612 (97) 00128-2. [PubMed] [CrossRef] [Google Scholar] 10. Хилл Р.Г., Уилсон А.Д. Некоторые структурные аспекты стекол, используемых в иономерных цементах. Glass Technol. 1988. 29: 150–188. [Google Scholar] 11. Стеббинс Дж. Ф., Кроекер С., Ли С. К., Киченски Т. Дж. Количественное определение пяти- и шестикоординированных ионов алюминия в алюмосиликатных и фторидсодержащих стеклах с помощью высокопольного ЯМР Al-27 с высоким разрешением.J. Non-Cryst. Твердые тела. 2000; 275: 1–6. DOI: 10.1016 / S0022-3093 (00) 00270-2. [CrossRef] [Google Scholar] 12. Стамбулис А., Хилл Р.Г., Ло Р.В. Структурная характеристика фторсодержащих стекол методами MAS-ЯМР спектроскопии F-19, Al-27, Si-29 и P-31. J. Non-Cryst. Твердые тела. 2005; 351: 3289–3295. DOI: 10.1016 / j.jnoncrysol.2005.07.029. [CrossRef] [Google Scholar] 13. Хилл Р.Г., Стамбулис А., Ло Р.В. Определение характеристик фторсодержащих стекол методами MAS-ЯМР спектроскопии F-19, Al-27, Si-29 и P-31. Дж.Вмятина. 2006; 34: 525–534. DOI: 10.1016 / j.jdent.2005.08.005. [PubMed] [CrossRef] [Google Scholar] 14. Шахид С., Хассан У., Биллингтон Р.В., Хилл Р.Г., Андерсон П. Стеклоиономерные цементы: влияние замещения стронция на эстетику, рентгеноконтрастность и высвобождение фторидов. Вмятина. Матер. 2014; 30: 308–313. DOI: 10.1016 / j.dental.2013.12.003. [PubMed] [CrossRef] [Google Scholar] 15. Крисп С., Льюис Б.Г., Уилсон А.Д. Характеристика стеклоиономерных цементов. 5. Влияние винной кислоты на жидкий компонент. J. Dent.1979; 7: 304–305. DOI: 10.1016 / 0300-5712 (79)
  • -X. [PubMed] [CrossRef] [Google Scholar] 16. Поттс П.Дж. Справочник по анализу силикатных пород. Блэки и сын; Глазго, Лондон, Великобритания: 1987. [Google Scholar] 17. Николсон Дж. У., Брукман П. Дж., Лейси О. М., Уилсон А. Д. Влияние (+) - винной кислоты на схватывание стеклоиономерных стоматологических цементов. J. Dent. Res. 1988. 67: 1451–1454. DOI: 10.1177 / 00220345880670120201. [PubMed] [CrossRef] [Google Scholar] 18. Крисп С., Прингер М.А., Уордлворт Д., Уилсон А.Д.Реакции в стеклоиономерных цементах. II. Инфракрасное спектроскопическое исследование. J. Dent. Res. 1974; 53: 1414–1419. DOI: 10.1177 / 00220345740530062001. [PubMed] [CrossRef] [Google Scholar] 19. Пирес Р., Нунес Т.Г., Абрахамс И., Хоукс Г.Э., Мораис К.М., Фернандес С. Исследования методом визуализации рассеянного поля и многоядерной магниторезонансной спектроскопии на установке промышленного стеклоиономерного цемента. J. Mater. Sci. Матер. Med. 2004. 15: 201–208. DOI: 10.1023 / B: JMSM.0000015479.65516.d0. [PubMed] [CrossRef] [Google Scholar] 20.Зайнуддин Н., Карпухина Н., Хилл Р.Г., Ло Р.В. Долгосрочное исследование реакции схватывания стеклоиономерных цементов методом 27 Al MAS-ЯМР спектроскопии. Вмятина. Матер. 2009. 25: 290–295. DOI: 10.1016 / j.dental.2008.07.008. [PubMed] [CrossRef] [Google Scholar] 21. Уоссон Э.А., Николсон Дж. У. Новые аспекты схватывания стеклоиономерных цементов. J. Dent. Res. 1993; 72: 481–483. DOI: 10.1177 / 00220345930720020201. [PubMed] [CrossRef] [Google Scholar] 22. Шахид С., Биллингтон Р.В., Пирсон Г.Дж. Роль состава стекла в стеклоуксусных и молочнокислых цементах.J. Mater. Sci. Матер. Med. 2008; 19: 541–545. DOI: 10.1007 / s10856-007-0160-z. [PubMed] [CrossRef] [Google Scholar] 23. Чарнецка Б., Клос Дж., Николсон Дж. В. Влияние ионных растворов на поглощение и связывание воды стеклоиономерными стоматологическими цементами. Ceram. Силик. 2015; 59: 292–297. [Google Scholar] 24. Таджиев Д., Хэнд Р.Дж. Гидратация поверхности и наноиндентирование силикатных стекол. J. Non-Cryst. Твердые тела. 2010; 356: 102–108. DOI: 10.1016 / j.jnoncrysol.2009.10.005. [CrossRef] [Google Scholar] 25.Эрл М.С.А., Маунт Дж. Дж., Хьюм В. Р. Влияние лаков и других средств обработки поверхности на движение воды по поверхности стеклоиономерного цемента. II. Aust. Вмятина. J. 1989; 34: 326–329. DOI: 10.1111 / j.1834-7819.1989.tb04641.x. [PubMed] [CrossRef] [Google Scholar] 26. Хиггс В.Дж., Лаксанасомбул П., Хиггс Р.Дж.Д., Суэйн М.В. Оценка прочности акрилового и стеклоиономерного цемента с помощью испытания на двухосный изгиб. Биоматериалы. 2001; 22: 1583–1590. DOI: 10.1016 / S0142-9612 (00) 00324-0. [PubMed] [CrossRef] [Google Scholar] 27.Маунт Дж. Дж., Макинсон О. Ф., Питерс М. К. Р. Б. Прочность автоотверждаемых и светоотверждаемых материалов. Испытание на удар сдвигом. Aust. Вмятина. J. 1996; 41: 118–123. DOI: 10.1111 / j.1834-7819.1996.tb05924.x. [PubMed] [CrossRef] [Google Scholar] 28. Форстен Л. Кратковременное и долгосрочное выделение фторида из стеклоиономеров. Сканд. J. Dent. Res. 1991; 99: 241–245. [PubMed] [Google Scholar] 29. Де Витте А.М., Де Майер Э.А., Вербек Р.М.Х., Мартенс Л.С. Профили высвобождения фторидов зрелых реставрационных стеклоиономерных цементов после нанесения фтора.Биоматериалы. 2000. 21: 475–482. DOI: 10.1016 / S0142-9612 (99) 00188-X. [PubMed] [CrossRef] [Google Scholar] 30. Де Моор Р.Г.Дж., Вербек Р.М.Х., Де Мейер Э.А.П. Профили высвобождения фторидов из реставрационных стеклоиономерных составов. Вмятина. Матер. 1996; 12: 88–95. DOI: 10.1016 / S0109-5641 (96) 80074-1. [PubMed] [CrossRef] [Google Scholar] 31. Николсон Дж. У., Чарнецка Б., Лимановска-Шоу Х. Долгосрочное взаимодействие стоматологических цементов с растворами молочной кислоты. J. Mater. Sci. Матер. Med. 1999; 10: 449–452. DOI: 10.1023 / А: 10089
  • «Ко»

    Стандартные стандартные стеклопакеты доступны толщиной D = 42 с коэффициентом теплопередачи R o = 0,60 2 o /, в котором используется полированное FLOAT - стекло производства концерна SAINT-GOBEIN, аргонозаполненные или стеклопакеты с энергосберегающими окнами с соответствующим коэффициентом Ro = 0,90 M2 Co / Вт.Дополнительно вместо алюминиевых проставок в стеклопекете устанавливаются специальные рамки THERMIX, которые создают терморазрыв между стеклами в краевых зонах, снижая теплопроводность, и повышают сопротивление теплопередаче R герметика в целом. Дополнительно вместо алюминиевых проставок в стеклопекете устанавливаются специальные рамки THERMIX, которые создают терморазрыв между стеклами в краевых зонах, снижая теплопроводность, и повышают сопротивление теплопередаче R герметика в целом. Для удовлетворения различных потребностей вашего дома в процессе проектирования предложены специальные окна с декоративными стеклопакетами, зеркальные, тонированные, ударопрочные (закаленные) и защитные стекла.Уровень шумозащиты у цокольных стекол не менее 37-38 дБ, и они подходят для комфортного проживания в любом районе города. В случае необходимости «антишумный» эффект усиливается до 43 дБ за счет использования многослойных стеклянных прокладок разной ширины и газообразного аргона. Назначение окна - обеспечивать естественное солнечное освещение помещения и защищать его от холода, жары, дождя и ветра. Из какого бы современного материала или несущей конструкции изготавливаются окна - пластик, теплоизолированный алюминий, дерево или композитный древесный евробрус - алюминий, стеклопакет чрезвычайно важен для определения теплозащитных качеств окна в целом (рис. 1.), Потому что окна обычно занимают большую часть окна, и через него происходят «утечки» тепла из помещения на окружающую территорию (рис. 2). Однако не все понимают, что оконные стекла - разные.

    РИС.1.ДИЗАЙН СТЕКЛО

    РИС. 2. ТРИ СПОСОБА ПОТЕРЯ ТЕПЛА В СТЕКЛЕ: ИЗЛУЧЕНИЕ, КОНВЕКЦИЯ, ТЕПЛОПЕРЕДАЧА.

    Таблица 1. Термическое сопротивление однокамерного стекла (R o )
    Формула запечатанная Обычное стекло обычное стекло + аргон Стакан One Low E Стекло One Low E + аргон
    4-8-4 0,328 0,358 0,461 0,578
    4-10-4 0,345 0,373 0,518 0,645
    4-12-4 0,356 0,382 0,552 0,662
    4-14-4 0,360 0,382 0,552 0,658
    4-16-4 0,358 0,380 0,546 0,649
    4-18-4 0,358 0,379 0,540 0,641
    4-20-4 0,356 0,377 0,534 0,633

    Учитывая численное выражение количества тепла через проходящее окно, характеризующееся величиной Ro, называемой «термостойкостью» (Таблица 1.), Мы видим, что однокамерный стеклопакет с обычным стеклом сегодня неприемлем для нового строительства и ремонта старых построек ни в одной из температурных зон Украины, в том числе и на крайнем юге, так как фактическое термическое сопротивление пакета меньше допустимого. нормативные значения? (Ro = 0,50 M2 Co / W) для III климатических зон Украины и (Ro = 0,60 M2 Co / W) для I и II климатичекских зон. Понятно, что таблицы, представленные на (Рис. 1,2), характеризуют термостекло и центральную область являются теоретическими, тогда как на практике эти значения могут быть хуже в краевых зонах остекления.Это связано с тем, что в конструкции для разделения оконных стекол обычно используются распорки (РИС.1.) Из алюминия, обладающие высокой теплопроводностью. Фактическое значение термического сопротивления каждой отдельной упаковки будет зависеть не только от выбранного окна, но и от соотношения площади и периметра стеклопакетов. Чем больше площадь уплотнения (например, большое окно), тем ближе значение к теоретическому аналогу Ro (Таблица 1, 2). В отличие от других производителей, мы предлагаем изготовленные на новой производственной линии компании «BAVELLONI» окна не только с традиционной алюминиевой распорной рамой, но и с теплой оконной рамой, в которой используется разделитель, специальные распорки «THERMIX» (Германия). (Рис.3.), который имеет очень низкую теплопроводность, что улучшает качество герметичного блока в целом и позволяет в холодное время года минимизировать риск образования конденсата на окнах в краевой зоне. Обратите особое внимание на то, что добротно сделанные современные окна герметичны и имеют совершенно противоположную сторону медали - при «неправильной» их эксплуатации могут возникнуть нежелательные эффекты запотевания стекол.Под «неправильной» эксплуатации в первую очередь понимается полное отсутствие или неадекватность частое проветривание помещения.Высокая влажность и низкая температура в помещении отрицательно влияют на возможность конденсации влаги на стеклопакетах. Во избежание образования конденсата на поверхности стекла нужно установить стеклопакеты с большим значением Ro и снизить влажность в помещении до приемлемых санитарных норм. В условиях постоянно растущих цен на энергию поддержание комфортных условий в наших домах обходится нам все дороже и дороже, и это относится как к зиме, так и к лету (кондиционирование воздуха).Поэтому вклад средств в энергоэффективные окна чрезвычайно выгоден для вас и ваших детей. Не столь существенная добавка к цене обычных стекол в энергосберегающих окнах с теплым зеркалом и теплыми распорками (рис. 3.) окупается всего за один-два зимних сезона.

    Таблица 2.Термостойкие трехкамерные окна (R o )
    Расстояние Толщина стекла () Начинка Обычное стекло Стакан One Low E
    8 28 воздух 0,495 0,645
    10 28 воздух 0,529 0,735
    12 36 воздух 0,556 0,800
    14 40 воздух 0,571 0,820
    16 44 воздух 0,580 0,810
    8 28 аргон 0,556 0,813
    10 32 аргон 0,585 0,917
    12 36 аргон 0,606 0,980
    14 40 аргон 0,617 0,980
    16 44 аргон 0,627 0,990

    РИС.ГОРЯЧИЙ ДИЗАЙН ПРОФИЛЬ «ТЕРМИКС».

    РИС. 4. СХЕМА СОХРАНЕНИЯ.

    Двухкамерные окна, заполненные аргоном, с энергоэффективными окнами и двумя распорками «THERMIX».

    D = 42 мм R o = 1,27 2 o /.

    Двойное остекление с двумя энергоэффективными окнами и I-стекло плюс распорки «THERMIX».

    D = 42 мм R o = 1,06 2 o /.

    Двухкамерные окна, заполненные аргоном, с одинарным энергосберегающим стеклом и двутавровым стеклом с разделителями «THERMIX».

    D = 42 мм R o = 0,9 2 o /.

    Тройное остекление с обычным остеклением и распорками "THERMIX".

    D = 42 мм R o = 0,60 2 o /.

    , где D - толщина стекла; Ro - пониженное сопротивление теплопередаче.

    Новейшая производственная линия компании "BAVELLONI" по производству стеклопакетов.

    Авторские маш. Все права защищены. - Разработано [email protected]

    Границы | Характеристики узлов с матовым стеклом, обнаруженных с помощью компьютерной томографии с низкой дозой в качестве регулярного обследования состояния здоровья сотрудников китайских больниц и их родителей

    Введение

    В последние годы во всем мире, особенно в Китае, для раннего скрининга рака легких применялась ежегодная НДКТ.LDCT был предложен в качестве регулярного обследования среди многих сотрудников отделений, среди которых многие не соответствуют критериям участников высокого риска согласно NLST. Наряду с широким применением НДКТ обнаруживалось все больше и больше узелков матового стекла. Международная программа действий по раннему раку легких сообщила, что нетвердые и частично твердые узелки были обнаружены в 9,2% из 57 496 исходных скринингов (1, 2). Zhang et al. (3) ретроспективно проанализировали скрининг LDCT среди 15 686 китайских сотрудников больниц и обнаружили, что 95.5% пациентов с выявленным при скрининге раком легких представляли собой узелки GGO на компьютерной томографии. Поскольку семейный анамнез является основным фактором риска рака легких, настоящее исследование сосредоточено на характеристиках и взаимосвязи узелков матового стекла, обнаруженных с помощью низкодозовой компьютерной томографии в качестве регулярного медицинского осмотра среди сотрудников китайских больниц и их родителей.

    Методы

    Участники и компьютерная томография

    НДКТ была проведена в рамках регулярного медицинского осмотра сотрудников больницы Сянъя старше 40 лет и родителей персонала старше 60 лет в период с 2019 по 2020 годы.Сотрудникам моложе 40 лет была предложена рентгенография, но некоторые из них перешли на НДКТ за свой счет. В общем, все участники были вызваны пройти тест. В исследовании использовалась компьютерная томография Revolution (GE Medical Systems) с толщиной среза 1,3 мм, шагом среза 1 мм, напряжением трубки 100 кВ, током трубки 40–100 мА.

    Клинические данные

    Были зарегистрированы узелки матового стекла, обнаруженные методом LDCT (GGNS) у сотрудников больниц и родителей. Была собрана и проанализирована клиническая информация, включая возраст, пол, статус курения.

    Измерения узелков

    Общество Флейшнера определило, что «узелок выглядит как округлая или неправильная непрозрачность, хорошо или плохо определяется, размером до 3 см в диаметре», а узелок из матового стекла (GGN) проявляется в виде повышенного затухания в легких не стирает края бронхов и сосудов (4). GGNs включают чистое матовое стекло и частично твердые узелки. Чистый матовый стеклянный узелок не имеет твердых компонентов. Частично твердый узелок состоит как из матового стекла, так и из твердых компонентов ослабления мягких тканей.ВСЯ информация об узелках была записана, в основном, из отчетов КТ, сделанных радиологом, если были какие-либо неоднозначные вопросы относительно узелков, радиолог проверил КТ изображения. Узелки измеряли по длине или диаметру по длинной и короткой оси. Узелки были классифицированы по категориям Lung Reporting and Data System (LU-RADS) (5).

    Статистический анализ

    Мы использовали тест Пирсона χ 2 , чтобы сравнить уровень обнаружения GGN, и парный t-тест, чтобы сравнить характеристики GGN в парах «сотрудник – родитель».Статистический анализ проводился в SPSS 23.0.

    Результаты

    Характеристики сотрудников больниц и GGN с обнаружением КТ

    Всего в больнице Xiangya было 5 574 сотрудника, из них 4 224 (75,78%) женщин и 1350 сотрудников-мужчин (24,22%). Общий уровень участия в НДКТ составил 28,38% (1582/5 574), среди них коэффициент участия женщин составил 25,33% (1070/4 224), коэффициент участия мужчин - 37,93% (512/1350). Процент пациентов, которым выполнялась КТ <40 лет, от 40 до 60 лет и> 60 лет, составлял 3.49% (120/3 442), 66,32% (961/1449), 73,35% (501/683) соответственно (таблица 1, рисунок 1).

    Рис. 1 Блок-схема исследования, в котором анализировались сотрудники больницы и их родители, выполняющие НДКТ в качестве регулярного обследования. НДКТ, компьютерная томография с низкой дозой облучения; GGNs, матовые стеклянные узелки.

    Таблица 1 Доля сотрудников, выполняющих НДКТ и имеющих GGN, в разбивке по полу и возрасту.

    Всего методом LDCT случайно обнаружено 392 узелка матового стекла (24.78%, 392/1582) в больницах. Среди сотрудников с GGN 290 (27,10%, 290/1070) составляли женщины и 102 (19,92%, 102/512) - мужчины; уровень обнаружения был значительно выше у женщин, чем у мужчин (27,10% против 19,92%, P = 0,002). Среди сотрудников с GGN 349 (89,02%) участников были некурящими. Уровень обнаружения GGN у сотрудников в возрасте <40 лет, от 41 до 60 лет и старше 60 лет составил 18,33% (22/120), 26,12% (251/961) и 23,75% (119/501), соответственно. 68,62% (269/392) имели одиночный GGN и 31.38% (123/392) имели несколько GGN. Было больше сотрудников с чистым GGN, чем сотрудников со смешанным GGN (331 против 61). Процент GGN <5 мм, 5–9 мм и ≥10 мм составил 27,30% (107/392), 63,77% (250/392) и 8,93% (35/392) соответственно. Согласно классификации LU-RADS, 113 (28,83%) сотрудников имели LU-RADS 2 GGN, 246 (62,75%) имели LU-RADS 3 GGN и 32 (8,42%) имели LU-RADS 4 GGN. Среди них было 11 узелков с LU-RADS 4B и 14 с LU-RADS 4C или 5 (таблица 2, рисунок 1).

    Таблица 2 Сравнение характеристик GGN у сотрудников с GGN у родителей.

    Характеристики родителей сотрудников больниц и КТ-обнаруженные GGN

    Всего в регулярном осмотре приняли участие 2686 родителей сотрудников ≥60 лет, средний возраст родителей составил 67,85 ± 6,18, из них 1338 женщин и 1348 человек. мужчина. Общий коэффициент участия LDCT составил 87,57% (2352/2686), коэффициент участия женщин и мужчин - 86,62% (1159/1338), 88.50% (1193/1348) соответственно.

    Общий уровень выявления GGN составил 10,80% (254/2352), среди них женщин - 12,68% (147/1159), мужчин - 8,97% (107/1193), уровень обнаружения был значительно выше у женщин, чем у мужчин ( 12,68% против 8,97%, P = 0,004). Среди родителей с GGN 195 участников не курили. Было больше родителей с чистым GGN, чем со смешанным GGN (214 против 40), и больше с одиночным GGN, чем с несколькими GGN (194 против 60). Процент GGNs <5 мм, 5–9 мм и ≥10 мм составлял 17.72% (45/254), 57,09% (145/254) и 25,19% (64/254) соответственно. Согласно классификации LU-RADS, 52 (20,47%) родителей имели LU-RADS 2 GGN, 150 (59,06%) имели LU-RADS 3 GGN и 49 (19,29%) имели LU-RADS 4 GGN, из них 20 были 4B, 25 были 4C или 5 (таблица 2, рисунок 1).

    Сравнение и корреляционный анализ GGN у сотрудников больниц и их родителей

    В целом, уровень обнаружения GGN был значительно выше в группе сотрудников, чем в родительской группе (24,78% против 10.80%, P < 0,001). Уровень обнаружения был значительно выше у женщин, чем у мужчин, как в группе сотрудников, так и в группе родителей, а доля женщин была больше, чем в группе родителей ( P < 0,001). В группе сотрудников было больше некурящих, чем в группе родителей ( P < 0,001). Как в группе сотрудников, так и в группе родителей было больше чистых GGN. В группе сотрудников было меньше участников с одиночным GGN, чем в родительской группе (68,62% против 76,38%, P = 0.033). Кроме того, было больше крупных GGN (≥10 мм) (25,19% против 8,93%, P <0,001), GGN LU-RADS 4 (19,29% против 8,16%, P <0,001) и GGN LU-RADS 4B (7,87% против 2,81%, P = 0,003), LU-RADS 4C-5 GGN (9,84% против 3,57%, P = 0,001) в группе родителей, чем в группе сотрудников (Таблица 2).

    36 пар (27,07%) имели GGN, из 133 пар сотрудников и их мать / отец выполняли LDCT. Женщин в этих парах было больше, чем мужчин (75%). GGN у сотрудников были меньше, чем у их родителей (6.11 ± 0,62 против 11,42 ± 1,38, F = 35, P <0,001), а категории LU-RADS были ниже у сотрудников, чем их родители (2,64 ± 0,11 против 3,22 ± 0,14, F = 35, P = 0,001). Частота множественных GGN составила 36,11% среди сотрудников и 33,33% среди родителей среди пар. Однако не было существенной разницы в плотности узелков у сотрудников и их родителей, ни по полу (таблица 3, рисунки 1, 2).

    Таблица 3 Сравнение возраста, пола и характеристик GGN среди трех групп в 133 парах сотрудников и их родителях, которые выполнили КТ.

    Рис. 2 Примеры GGN в группах пар «сотрудник-родитель». (A) сотрудник 1, женщина, 42 года, частично твердый узелок в правой верхней доле, 15 × 10 мм, LU-RADS 4C; (B) мать сотрудника 1, 67 лет, частично твердый узелок в правой верхней доле, 25 × 18 мм, LU-RADS 5; (C) сотрудник 2, женщина, 51 год, чистый-GGN в левой нижней доле, 5 мм, LU-RADS 3; (D) мать сотрудника 2, 73 года, частично твердый узелок в правой верхней доле, 13 мм, LU-RADS 4C; (E) сотрудник 3, мужчина, 51 год, чистый-GGN в правой нижней доле, 6 мм, LU-RADS 3; (F) мать сотрудника 3, 79 лет, чистый GGN в правой нижней доле, 14 × 9 мм, LU-RADS 4B.

    Шестьдесят два сотрудника имели только GGN, а их родитель - нет. Среди них 80,65% (50/62) были женщинами, 91,94% (57/62) имели чистый GGN и 72,58% (45/62) были одиночными GGN. Однако только 1 из 62 (1,6%) имел GGN ≥10 мм, а 2 из 62 (3,2%) были классифицированы как LU-RADS 4. При сравнении этих 62 сотрудников с этими сотрудниками в группе из 36 пар «сотрудник-родитель» не было обнаружено значимых разница в возрасте, поле и плотности, количестве, размере, категории LU-RADS GGN ( P> 0,05) (таблица 3, рисунок 1).

    Тридцать пять родителей имели только GGN, а их сын / дочь - нет. Среди них 74,29% (26/35) были матерями, 85,71% (30/35) имели чистый GGN и 62,86% (22/35) были одиночными GGN. Тем не менее, 6 из 35 (17,14%) имели GGNS ≥10 мм, а 4 из 35 (11,43%) были классифицированы как LU-RADS 4. По сравнению с этими 35 родителями в группе из 36 пар сотрудник-родитель, родители были старше ( P = 0,012) в последней группе и было больше крупных GGN ( P = 0,042) и узелков LU-RADS 4-5 ( P = 0.015) (таблица 3, рисунок 1).

    Обсуждение

    Из-за применения скрининга LDCT для ранней стадии рака легких, количество случаев рака легких, появившихся в виде GGO или GGN, увеличивается. GGO / GGN - это неспецифическая радиологическая находка, которая может быть вызвана воспалением, неопластической пролиферацией и т. Д. В Азии узелки GGO были обнаружены у 7,5% из 2255 бессимптомных взрослых корейцев (6) и у 28,69% из 1279 положительных участников LDCT в программе скрининга в Тайване, Китай (7). В нашем исследовании доля GGN, обнаруженных с помощью скринингового КТ, составила 24.78% в группе сотрудников и 10,80% в группе родителей. Различный уровень обнаружения среди исследований, вероятно, связан с разными методами расчета, возрастом населения и методами проведения. В исследовании на корейском языке участники были старше 45 лет, и использовались КТ-аппараты толщиной 5 мм с интервалом 4 мм. Однако в исследовании на Тайване участникам было 19–86 лет, и узелки диаметром> 4 мм были определены как положительные, все компьютерные томографии выполнялись на аппаратах для тонких срезов (0,625 мм).

    По мере увеличения возраста участников Zhang et al. показали, что частота выявления рака легких постепенно увеличивается в группах «возраст ≤40 лет», «40 <возраст ≤ 55 лет» и «возраст> 55 лет» соответственно (2). Однако мы не обнаружили значительного увеличения частоты выявления GGN с возрастом, наиболее значительный показатель был в группе «от 41 до 60 лет», но было больше крупных узелков высокой степени злокачественности, представляющих высокий риск злокачественных новообразований в старшей группе. . Наши результаты показали, что возраст является ключевым фактором риска злокачественных новообразований, что подтверждается исследованием Чжана.Кроме того, Ли и др. с помощью кумулятивного метаанализа обнаружили, что средний возраст при постановке диагноза значительно снизился с 66,40 до 59,06 за последние два десятилетия (8).

    Многие авторитетные руководящие принципы предлагают тяжелое курение в качестве ключевого фактора для оценки риска рака легких, что означает, что большинство женщин не имеют права на скрининг рака легких. Однако все больше и больше исследований показывают, что доля некурящих женщин с раком легких в последние годы увеличивается, особенно в Восточной Азии.Она и др. обнаружили, что 587 (65%) из 898 случаев с единичными чистыми GGNs, патологически подтвержденными как аденокарцинома легких, были женскими в Шанхае, Китай (9). Hattori et al. из Японии оценили 616 хирургически удаленных клинических случаев немелкоклеточного рака легкого N0M0 и обнаружили, что процент женщин составил 62% (10). Исследование, проведенное в Корее, показало, что 162 (56%) женщины из 288 пациентов (некурящие 68,1%) имели аденокарциному легкого, подтвержденную хирургическим путем и обозначенную как GGN (11). В нашем исследовании уровень выявления был значительно выше у женщин, чем у мужчин, как в группе сотрудников (некурящие, 89.02%) или родительской группы (некурящие, 76,72%), а также в каждой возрастной группе. Наше исследование полностью соответствовало этим исследованиям, так как причины этих результатов все еще неоднозначны. Это может быть связано с генетической предрасположенностью (например, с высокой частотой мутации EGFR) (12), эстрогеном и рецепторами (13), загрязнением воздуха в помещении (например, курение или приготовление пищи) (14, 15) и историей заболеваний легких. , однако необходимо дальнейшее расследование. Что касается некурящих, особенно женщин из Азии, стоит определить факторы высокого риска рака легких на основе возможных причин, указанных выше.Возможно, следует разработать новый скорректированный критерий скрининга для этой группы населения, чтобы достичь эффективной ранней диагностики и лечения рака легких.

    В нашем исследовании было выявлено, что 27% пар «сотрудник – родитель» одновременно имели GGN. Этот результат напомнил нам, что GGN могут быть связаны с генетическими факторами, семейным окружением и жизненными привычками. В последние десятилетия многие исследования неизменно показывают, что семейный анамнез является важной этиологией рака, особенно рака легких. Ooi et al. (16) обнаружили, что риск рака легких у пациентов с семейным анамнезом рака легких составлял 2.В 4 раза по сравнению с лицами без семейного анамнеза. Guo et al. (17) показали, что риск рака легких у родственников первой степени родства больных раком легкого был примерно в семь раз выше, чем у здоровых людей. Тем не менее, в настоящее время существует несколько исследований по генетике, семейному анамнезу и привычкам жизни, касающимся GGN. Поскольку большинство GGN остаются в процессе наблюдения, и немногие участники прошли резекцию, на сегодняшний день у нас больше нет генетической информации между ними.

    Что касается рака легких, то было доказано, что генетика является ключевой этиологией, но остается неопределенным в отношении семейного анамнеза и жизненных привычек.Таким образом, мы можем продолжить изучение потенциальной значимости пар «сотрудник-родитель».

    Более того, предыдущие исследования показали, что родственницы первой степени родства женского пола были более сильным предиктором рака легких, чем родственники первой степени родства мужского пола, а член семьи первой степени родства с диагнозом рака до 50 лет был связан с повышенным риском рака легких, особенно среди никогда не куривших. (18–21). В нашем исследовании было больше женщин (75%), чем мужчин, которые выявляли GGN, когда их родители тоже имели GGN, и все они были некурящими.Это может указывать на то, что у некурящих женщин больше шансов получить генетическую предрасположенность к GGN от родителей. Кроме того, мы обнаружили, что GGN у сотрудников были меньше и хуже, чем узелки у их родителей среди 36 пар «сотрудник-родитель». Мы предположили, что узелки у сотрудников будут на более ранней стадии и превратятся в узелки, как у их родителей, когда они стареют. Мы также обнаружили, что GGN родителей в группе пары «сотрудник-родитель» были крупнее и выше, чем GGN только для родителей. Предполагает ли это, что более крупные и подозрительные узелки с большей вероятностью передаются потомству, требует дальнейшего исследования.

    Заключение

    Наше исследование ретроспективно проанализировало обнаруженные LDCT GGN среди сотрудников и родителей. Среди сотрудников и родителей, у которых были узелки матового стекла, 1/4 из них оба обнаружили GGN. Хотя уровень обнаружения GGN в родительской группе был ниже, чем в группе сотрудников, уровень узелков был значительно выше. Все это предполагает, что возникновение и развитие клубеньков матового стекла может быть связано с генетическими факторами.

    Заявление о доступности данных

    Исходные материалы, представленные в исследовании, включены в статью / дополнительные материалы.Дальнейшие запросы можно направить соответствующему автору.

    Заявление об этике

    Исследования с участием людей были рассмотрены и одобрены Центром медицинской этики Медицинского колледжа Сянъя при Центрально-Южном университете. Пациенты / участники предоставили письменное информированное согласие на участие в этом исследовании.

    Вклад авторов

    Б.О. в основном завершил обработку данных исследования, создание диаграмм и написание статей. MaL, LL и SL помогли собрать клиническую информацию.MiL в основном занимался разработкой исследования, участвовал в обсуждении результатов и редактировал проект. Все авторы внесли свой вклад в статью и одобрили представленную версию.

    Конфликт интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

    Управляющий редактор заявил о совместной принадлежности с несколькими авторами MaL, LL, SL и MiL во время рецензирования.

    Выражение признательности

    Это исследование было поддержано Национальным многопрофильным совместным проектом по диагностике и лечению основных заболеваний (рак легких).

    Ссылки

    1. Янкелевиц Д.Ф., Ип Р., Смит Дж. П., Лян М., Лю Ю., Сюй Д.М. и др. КТ-скрининг рака легких: нетвердые узелки в базовых и ежегодных повторных раундах. Радиология (2015) 277 (2): 555–64. doi: 10.1148 / radiol.2015142554

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    2.Хеншке К.И., Ип Р., Смит Дж. П., Вольф А.С., Флорес Р.М., Лян М. и др. КТ-скрининг рака легкого: частичные твердые узелки в базовых и ежегодных повторных раундах. AJR Am J Roentgenol (2016) 207 (6): 1176–84. doi: 10.2214 / AJR.16.16043

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    3. Чжан И, Чжон С., Ли Х, Чжан Х, Се И, Цянь Б. и др. Результаты низкодозовой компьютерной томографии как регулярного обследования здоровья сотрудников китайских больниц. J Thoracic Cardiovasc Surg (2020) 16 (3): 824–31.doi: 10.1016 / j.jtcvs.2019.10.145

    CrossRef Полный текст | Google Scholar

    4. Hansell DM, Bankier AA, MacMahon H, McLoud TC, Müller NL, Remy J. Fleischner Society: глоссарий терминов для торакальной визуализации. Радиология (2008) 246 (3): 697–722. doi: 10.1148 / radiol.2462070712

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    5. Манос Д., Сили Дж. М., Тейлор Дж., Боргаонкар Дж., Робертс Х. С., Мэйо-младший. Система отчетов и данных по легким (LU-RADS): предложение по компьютерной томографии. Can Assoc Radiol J (2014) 65 (2): 121–34. doi: 10.1016 / j.carj.2014.03.004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    6. Чонг С., Ли К.С., Чунг М.Дж., Ким Т.С., Ким Х., Квон О.Дж. и др. Скрининг рака легких с помощью спиральной КТ в низких дозах в Корее: опыт в медицинском центре самсунг. J Korean Med Sci (2005) 20 (3): 402–8. doi: 10.3346 / jkms.2005.20.3.402

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    7. Chen CY, Chen CH, Shen TC, Cheng WC, Hsu CN, Liao CH, et al.Скрининг рака легких с помощью компьютерной томографии с низкой дозой облучения: опыт высокоспециализированной больницы на Тайване. J Formos Med Assoc (2016) 115 (3): 163–70. doi: 10.1016 / j.jfma.2015.11.007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    8. Ли Х, Рен Ф, Ван С., Хе З, Сонг З, Чен Дж и др. Эпидемиология аденокарциномы легких с матовым стеклом: кумулятивный метаанализ на основе сети. Front Oncol (2020) 10: 1059. doi: 10.3389 / fonc.2020.01059

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    9.She Y, Zhao L, Dai C, Ren Y, Zha J, Xie H и др. Предоперационная номограмма для выявления инвазивной аденокарциномы легких у пациентов с чистым матовым стеклом: мультиинституциональное исследование. Oncotarget (2017) 8 (10): 17229–38. doi: 10.18632 / oncotarget.11236

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    10. Хаттори А., Мацунага Т., Такамочи К., О С., Сузуки К. Ни максимальный размер опухоли, ни размер твердого компонента не являются прогностическими при частичном твердом раке легкого: влияние размера опухоли следует применять исключительно к солидному раку легкого . Ann Thorac Surg (2016) 102 (2): 407–15. DOI: 10.1016 / j.athoracsur.2016.02.074

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    11. Choi SH, Chae EJ, Shin SY, Kim EY, Kim JE, Lee HJ, et al. Сравнение клинических исходов у пациентов с предоперационной тканевой диагностикой и без нее при наличии стойких злокачественных узлов с матовым стеклом. Med (Балтимор) (2016) 95 (34): e4359. doi: 10.1097 / MD.0000000000004359

    CrossRef Полный текст | Google Scholar

    12.Steuer CE, Behera M, Berry L, Kim S, Rossi M, Sica G и др. Роль расы в распространенности онкогенных факторов и исходах аденокарциномы легких: результаты консорциума мутации рака легких [J]. Рак (2016) 122 (5): 766–72. doi: 10.1002 / cncr.29812

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    14. Ли В., Цзе Л.А., Au JSK, Ван Ф., Цю Х., Ю. ИТ. Пассивное курение увеличивает риск рака легких у курящих мужчин: взаимодействие [J]. Nicotine Tob Res (2016) 18 (11): 2057–64.doi: 10.1093 / ntr / ntw115

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    15. Chen HC, Wu CE, Chong IW, Wu MT. Воздействие паров растительного масла и хронический бронхит у некурящих женщин в возрасте 40 лет и старше: медицинское исследование [J]. BMC Public Health (2018) 18 (1): 246. doi: 10.1186 / s12889-018-5146-x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    16. Ooi WL, Elston RC, Chen VW, Bailey-Wilson JE, Rothschild H. Повышенный семейный риск рака легких. J Natl Cancer Inst (1986) 76 (2): 217–22.

    PubMed Аннотация | Google Scholar

    17. Guo ZR, Lu QX. Исследование факторов агрегации рака легких [J]. Hereditas (1987) 1: 32–5.

    Google Scholar

    18. Wu PF, Lee CH, Wang MJ, Goggins WB, Chiang TA, Huang MS. Агрегация рака и комплексный анализ сегрегации семей с некурящими пробандами рака легкого на Тайване. Eur J Cancer (2004) 40 (2): 260–6. DOI: 10.1016 / j.ejca.2003.08.021

    PubMed Реферат | CrossRef Полный текст | Google Scholar

    19. Gao Y, Goldstein AM, Consonni D, Pesatori AC, Wacholder S, Tucker MA, et al. Семейный анамнез рака и незлокачественных заболеваний легких как факторов риска рака легких. Int J Cancer (2009) 125 (1): 146–52. doi: 10.1002 / ijc.24283

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    20. Brenner DR, Hung RJ, Tsao MS, Shepherd FA, Johnston MR, Narod S, et al.Риск рака легких у некурящих: популяционное исследование эпидемиологических факторов риска. BMC Cancer (2010) 10 (14): 285. doi: 10.1186 / 1471-2407-10-285

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    21. Lin H, Huang YS, Yan HH, Yang XN, Zhong WZ, Ye HW, et al. Семейный анамнез рака и риска рака легких у некурящих: клиническое исследование случай-контроль. Рак легких (2015) 89 (2): 94–8. doi: 10.1016 / j.lungcan.2015.05.017

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Apple Watch Series 3 | Даты выпуска, характеристики, характеристики, цены


    Apple представила третье поколение линейки Apple Watch во время мероприятия Apple в сентябре 2017 года.Apple Watch Series 3 улучшили своих предшественников за счет обновленных компонентов и модели с сотовой связью.

    Apple Watch Series 3 Стоимость

    Apple Watch Series 3 стоит 199 долларов за 38 мм и 229 долларов за 42 мм. Хотя изначально у нее был сотовый вариант, теперь эта модель продается только с GPS.

    Apple Watch Series 3 Характеристики

    Внешний вид

    Снаружи эти Apple Watch имеют тот же знакомый дизайн, что и Apple Watch Series 2, с квадратным OLED-дисплеем Retina, защищенным сапфировым стеклом в моделях из нержавеющей стали и керамики и стеклом Ion-X для алюминиевых версий.Доступная в двух размерах, 38-миллиметровая модель имеет разрешение 272 x 340 пикселей, а 42-миллиметровая модель имеет дисплей 312 x 390 пикселей. Оба имеют яркость 1000 нит.

    Это было первое поколение, которое включало сотовую связь и связанную с ней красную точку на Digital Crown.

    Справа от устройства находятся боковая кнопка и цифровая корона, которые используются вместе с касаниями дисплея, смахиваниями и жестами для навигации по меню watchOS. Digital Crown была одним из немногих элементов, визуально изменившихся в этом поколении: устаревшие модели сотовой связи отмечены красной точкой, обозначающей их дополнительную возможность подключения.

    Сзади находится датчик сердечного ритма, набор светодиодов и датчиков, которые могут определять кровоток в запястье пользователя. Это делается с помощью технологии, известной как фотоплетизмография. Apple увеличила размер заднего кристалла, но всего на 0,25 миллиметра, что сделало его едва заметным изменением для подавляющего большинства пользователей.

    Задняя крышка Apple Watch также предлагалась из двух различных материалов, в зависимости от модели. Стандартная версия без сотовой связи имеет «композитную заднюю панель», тогда как модели с LTE используют керамическую заднюю панель.

    Общие технические условия

    Как обычно, Apple внесла изменения во внутреннее устройство Apple Watch, улучшив их производительность и функции по сравнению с предыдущими моделями.

    Для умных часов третьего поколения Apple разработала процессор S3, двухъядерный чип, который может похвастаться увеличением производительности на 70% по сравнению с S2. Помимо обеспечения более быстрого запуска приложений и более плавной графики по сравнению с предшественником, это дополнение также позволило Siri ответить пользователю, используя встроенный динамик Apple Watch.

    Вместе с S3 является разработанный Apple беспроводной чип W2, который делает соединения Wi-Fi на 85% быстрее, в то же время делая Bluetooth и Wi-Fi на 50% более энергоэффективными.

    В некоторых моделях была увеличена емкость памяти. Стандартная модель имеет 8 гигабайт памяти, а сотовая версия - 16 гигабайт. Сегодня Apple продает только версию GPS на 8 ГБ.

    Новым в выпуске 2017 года стал барометрический альтиметр, используемый для определения того, насколько высоко Apple Watch находятся над уровнем моря.Датчик используется для различных действий, например для набора высоты и подсчета пройденных лестничных пролетов.

    Apple Watch также включает гироскоп, акселерометр и датчик внешней освещенности, а также задний датчик сердечного ритма. Все модели включают поддержку Wi-Fi 802.11n, а также возможность подключения Bluetooth 4.2.

    Водонепроницаемость устройства составляет 50 метров.

    Сотовая связь

    Сотовые Apple Watch Series 3

    Apple предложила два типа Apple Watch в этой модели 2017 года.Компания присвоила стандартной модели суффикс «GPS», а модель сотовой связи обозначила «GPS + Cellular». Эта вторая модель имеет собственное сотовое радио, что позволяет ей подключаться к мобильной сети независимо. Это позволяет ему работать без привязки к ближайшему iPhone.

    У него есть красная точка на цифровой короне, указывающая на то, что у него есть возможности сотовой связи.

    Используя полноценное сотовое радио LTE и UMTS, на которое Apple Watch легко переключаются, если iPhone находится вне зоны действия, Apple Watch могут связываться с различными онлайн-сервисами.Сюда могут входить сервисы потокового аудио, такие как Apple Music, доступ к Find My Friends, Messages и сторонние приложения, такие как WeChat.

    Потоковая передача

    Apple Music через Apple Watch была доступна не сразу. Позже Apple представила его как часть обновления для watchOS 4.1 в октябре 2017 года. Потоковая передача через соединение LTE влияет на время автономной работы, подобно тому, как потоковая передача при использовании встроенной функции GPS может сократить время использования до трех часов.

    Вы можете назначить часам тот же номер телефона и учетную запись, что и ваш iPhone, с которым выполнено сопряжение.Это позволяет передавать текстовые сообщения и звонки на Apple Watch, даже если они находятся далеко от вашего iPhone. Вы также можете принимать и совершать звонки, используя встроенный динамик и микрофон Apple Watch. Однако он также будет работать в паре с AirPods для более приватной беседы.

    Чтобы добавить возможность подключения LTE без изменения дизайна или размера, Apple использовала встроенную eSIM. Это конструктивное решение занимает одну сотую места традиционной SIM-карты, избавляя от необходимости добавлять слот для SIM-карты.Дисплей также служит антенной для Apple Watch для сотовой связи, вместо того, чтобы использовать отдельный воздушный компонент.

    Из-за особенностей того, как Apple Watch Series 3 могут подключаться к телефонной сети, они будут работать только через ограниченное количество операторов, список Apple опубликовал на своем веб-сайте. В Соединенных Штатах поддерживаемые операторы включают AT&T, Sprint, T-Mobile и Verizon, при этом ожидается, что клиенты будут платить 10 долларов в месяц за добавление устройства в свой тарифный план.

    часы OS 7

    Отслеживание сна - одна из важнейших функций watchOS 7

    Apple объявила о следующем крупном обновлении ОС для Apple Watch, watchOS 7, на WWDC 2020. Обновление было выпущено в сентябре 2020 года. Существенные изменения включают таймеры мытья рук, отслеживание сна и показатели мобильности. Apple Watch Series 3 и новее могут перейти на обновление.

    Система отслеживания сна, включенная в watchOS 7, основывается на базовом слежении, предлагаемом в «Время сна», и предоставляет больше данных о том, как спит пользователь.Отслеживая небольшие движения с помощью встроенного акселерометра, пользователи могут видеть, насколько хорошо они спали, а также иметь возможность отслеживать свой долгосрочный режим сна.

    Включены новые методы тренировок, такие как танцы, основные тренировки, функциональные силовые тренировки и кулдауны. Эти типы тренировок не так легко отслеживать, как другие, которые предлагались ранее. Обновление также поддерживает Apple Fitness +, новую интегрированную службу потоковой передачи и отслеживания тренировок.

    Apple также внесла изменения в циферблаты.На новом циферблате Chronograph Pro добавлен тахометр, используемый для расчета скорости на основе времени прохождения фиксированного расстояния. Разработчики также могут добавить более одного усложнения для каждого приложения на один циферблат.

    Совместное использование циферблатов - еще одно важное изменение, позволяющее пользователям делиться своими творениями с другими через сообщения, URL-адреса или долгое нажатие на циферблат Apple Watch. Apple также курирует конфигурации циферблатов Apple Watch.

    Мытье рук в watchOS 7

    Последнее обновление включает отслеживание мытья рук.Когда Apple Watch обнаруживают, что пользователь моет руки, например, слышит звук проточной воды, на дисплее отображается 20-секундный таймер, чтобы убедиться, что пользователь должным образом моет руки. Как и в случае с отслеживанием сна, приложение Health предоставит подробную информацию о том, как часто пользователь моет руки, а также предложит дополнительные советы по ограничению распространения болезней.

    Наряду с обновлениями, внесенными в Apple Maps на iOS, также вносятся изменения, отражающие возможности Apple Watch, включая пошаговые инструкции с приоритетом велосипедных маршрутов.Сюда входит возможность исключать маршруты с лестницей и предупреждения о крутых подъемах.

    Apple также улучшает то, как Siri выполняет диктовку на устройстве. Это должно помочь повысить точность передачи голосовых сообщений. Также доступен доступ к другим функциям, включая новые возможности перевода Siri.

    Стили и ленты

    Помимо размеров 38 мм и 42 мм, изначально было много моделей Apple Watch Series 3 вместе с различными ремешками.Сегодня Apple продает модель 2017 года только в черно-белом варианте со спортивными ремешками.

    Первоначально стандартными вариантами цвета для версий с алюминиевым корпусом были Silver, Space Grey и новое дополнение Gold. Каждый также включал группу. К ним относятся оригинальный спортивный ремешок или спортивная петля, которые можно легко закрепить на запястье с помощью небольшой петли.

    Корпуса из нержавеющей стали включают варианты Silver и Space Black. Их можно сочетать со спортивным ремешком или миланской петлей соответствующей цветовой гаммы.

    Модели Nike +, возвращенные с этим поколением, в комплекте с вариантами фирменных ремешков Nike Sport Band и Nike Sport Loop различных цветов, предназначенных для спортсменов.

    Ремешок Sport Loop дебютировал в этом поколении.

    Apple Watch Nike + также поставляется с эксклюзивными циферблатами. Кроме того, он может запустить приложение Nike + Run Club, нажав на специальное усложнение. Nike обновила свое приложение Nike + Run Club 2 октября перед запуском модели Nike +, добавив пробежки с аудиогидом, функцию социальных сетей «Ура» и функцию истории активности.

    В моделях Apple Watch Hermes в этом поколении появилось больше вариантов кожаных ремешков, в том числе Single Tour Rallye из перфорированной телячьей кожи Gala, вдохновленной классическими перчатками Hermes для вождения, а также Single Tour Eperion d'Or на основе конного спорта. узор шарфа разработан Анри д'Ориньи. Эти модели также включали новый циферблат, вдохновленный часами Carrick Hermes, разработанными Анри д'Ориньи в 1993 году.

    Еще одна группа Hermes, выпущенная в декабре 2017 года, представила модель Noir Swift Leather Tour Medor в 38-миллиметровом формате по цене 589 долларов за одну только группу.

    В премиальных моделях Apple Watch Edition использовались керамические корпуса. Они были доступны в черном или белом цвете с соответствующим спортивным ремешком.

    Новые варианты спортивного ремешка, выпущенные в онлайн-магазине Apple Store в декабре 2020 года. Новые варианты по цене 49 долларов США включают темно-бирюзовый, пряно-оранжевый и канареечно-желтый «Flash» ремешок.

    Разборка Apple Watch Series 3

    Обычная деконструкция с помощью iFixit для третьего поколения Apple Watch показала, что, хотя он во многом был похож на Series 2, Apple внесла некоторые улучшения во внутреннее устройство Series 3.

    Модель LTE включала в себя «совершенно новую секцию» радиочастотных чипов, причем ST Microelectronics, как полагают, предоставила компоненты, составляющие eSIM. Другие чипы, наряду с беспроводным чипом Apple W2, пришли, в частности, от Avago и Skyworks, а барометрический альтиметр был перемещен в новое место рядом с микрофоном.

    Примечательно, что батарея в Series 3 имеет емкость 1,07 ватт-час. Он обеспечил увеличение почти на 4% по сравнению с батареей емкостью 1,03 ватт-час в Series 2. Тем не менее, это все же говорит о том, что Apple полагается на усовершенствования микросхем в других местах, чтобы компенсировать энергопотребление связи LTE.

    iFixit дал ему оценку ремонтопригодности 6 из 10. Большинство операций по ремонту материнской платы и микроспайке сменных компонентных кабелей недоступны для большинства пользователей. Однако теоретически можно заменить экран и батарею, если есть подходящие инструменты и детали.

    Вызов службы экстренной помощи

    Сотовые модели Apple Watch Series 3 можно идентифицировать по красной цифровой короне.

    Возможность совершать телефонные звонки на Apple Watch Series 3, оснащенных LTE, сделала несуществующий сотовый вариант ныне несуществующего носимого устройства удобным в чрезвычайной ситуации.Он мог запросить помощь с функцией экстренной помощи. Вы запускаете это, удерживая боковую кнопку на часах в течение длительного периода времени. После этого он в конечном итоге отправляет текстовые сообщения контактам в экстренных случаях или звонит в службы экстренной помощи.

    В ноябре 2020 года плакат Reddit попытался использовать эту функцию на неактивированных часах под управлением watchOS 4.1, но сначала потерпел неудачу. После электронного письма от Apple Executive Relations, в котором объясняется, что функцию можно активировать без активации, во втором тесте через три минуты позвонили в службу 911.

    Одним из первых примеров работы функции экстренной экстренной помощи Apple Watch была история кайтсерфинга Джона Зиллеса в ноябре 2020 года, который разбил свое судно на подводных крыльях в кишащих акулами водах в миле от побережья Калифорнии. Используя Apple Watch, Зиллес позвонил своему сыну, чтобы тот отправил свой номер в патруль порта, прежде чем сам позвонить. Позже его спас патрульный катер.

    Функция Emergency SOS также помогла спасти жизнь одной женщине в конце 2017 года, когда пьяный водитель сбил машину сзади, заставив ее взлететь в воздух.У Кэси Андерсон, которая вызвала тревогу на своих Apple Watch после восстановления после потери сознания, было обнаружено серьезное сотрясение мозга, отек мозга и выпуклые диски в результате аварии, и она все еще восстанавливается после травм.

    Преодоление хрупкости стекла с помощью био-вдохновения и микроархитектуры

  • 1

    Яхьязадефар, М., Баджадж, Д. и Арола, Д. Д. Скрытый вклад эмалевых стержней в сопротивление разрушению человеческих зубов. Acta. Биоматер. 9 , 4806–4814 (2013).

    CAS Статья Google Scholar

  • 2

    Карри Дж. Д. и Тейлор Дж. Д. Механическое поведение некоторых твердых тканей моллюсков. J. Zool. 173 , 395–406 (1974).

    Артикул Google Scholar

  • 3

    Джексон, А. П., Винсент, Дж. Ф. В. и Тернер, Р. М. Механический дизайн перламутра. Proc. R. Soc. Лондон. B 234 , 415–440 (1988).

    ADS Статья Google Scholar

  • 4

    Бартелат, Ф., Танг, Х., Заваттьери, П. Д., Ли, К. М. и Эспиноза, Х. Д. О механике перламутра: ключевой момент в иерархической структуре материала. J. Mech. Phys. Твердые тела 55 , 306–337 (2007).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 5

    Катти, Д.Р., Катти, К. С., Сопп, Дж. М. и Сарикая, М. Трехмерное конечно-элементное моделирование механического отклика в гибридных нанокомпозитах на основе перламутра. Comput. Теор. Polym. Sci. 11 , 397–404 (2001).

    CAS Статья Google Scholar

  • 6

    Ван Р. З., Суо З., Эванс А. Г., Яо Н. и Аксай И. А. Механизмы деформации перламутра. J. Mater. Res. 16 , 2485–2493 (2001).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 7

    Espinosa, H.Д., Рим, Дж. Э., Бартелат, Ф. и Бюлер, М. Дж. Слияние структуры и материала в перламутре и кости - Перспективы биомиметических материалов de novo. Прог. Матер. Sci. 54 , 1059–1100 (2009).

    CAS Статья Google Scholar

  • 8

    Wondraczek, L. et al. К сверхпрочным очкам. Adv. Матер. 23 , 4578–4586 (2011).

    CAS Статья Google Scholar

  • 9

    Девиль, С., Саиз, Э., Налла, Р. К. и Томсиа, А. П. Замораживание как путь к созданию сложных композитов. Наука 311 , 515–518 (2006).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 10

    Munch, E. et al. Прочные, биологические гибридные материалы. Наука 322 , 1516–1520 (2008).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 11

    Тан, З., Котов, Н.А., Магонов, С., Озтюрк, Б. Наноструктурированный искусственный перламутр. Nat. Матер. 2 , 413–418 (2003).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 12

    Бондерер, Л. Дж., Стударт, А. Р. и Гауклер, Л. Дж. Биоинспектированный дизайн и сборка полимерных пленок, армированных пластинками. Наука 319 , 1069–1073 (2008).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 13

    Подсядло, п.и другие. Сверхпрочные и жесткие слоистые полимерные нанокомпозиты. Наука 318 , 80–83 (2007).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 14

    Уолли П., Чжан Ю. и Эванс Дж. Самостоятельная сборка монтмориллонитовых пластинок во время сушки. Bioinspir. Биомим. 7 , 046004 (2012).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 15

    Эспиноза, Х.D. et al. Происхождение упрочнения на уровне таблеток в панцирях морского морского ушка и переход на синтетические композитные материалы. Nat. Commun. 2 , 173 (2011).

    Артикул Google Scholar

  • 16

    Бартелат, Ф. и Чжу, Д. Дж. Новый биомиметический материал, повторяющий структуру и механику натурального перламутра. J. Mater. Res. 26 , 1203–1215 (2011).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 17

    Ричи Р.О. Конфликт между силой и стойкостью. Nat. Матер. 10 , 817–822 (2011).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 18

    Rousseau, M. et al. Многоуровневая структура листового перламутра. Биоматериалы 26 , 6254–6262 (2005).

    CAS Статья Google Scholar

  • 19

    Сарыкая М., Аксай И.A. Биомиметика, дизайн и обработка материалов. Полимеры и сложные материалы Американский институт физики (1995).

  • 20

    Хайер Дастджерди А., Рабей Р. и Бартелат Ф. Слабые границы раздела в твердых природных композитах: эксперименты с тремя типами перламутра. J. Mech. Behav. Биомед. Матер. 19 , 50–60 (2013).

    Артикул Google Scholar

  • 21

    He, M. Y., Эванс, А. Г. и Хатчинсон, Дж. У. Прогиб трещин на границе раздела между разнородными упругими материалами: роль остаточных напряжений. Внутр. J. Solids Struct. 31 , 3443–3455 (1994).

    Артикул Google Scholar

  • 22

    Имбени В., Крузич Дж. Дж., Маршалл, Г. У., Маршалл, С. Дж. И Ричи, Р. О. Соединение дентин-эмаль и перелом зубов человека. Nat. Матер. 4 , 229–232 (2005).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 23

    Крузич, Дж., Налла, Р. К., Кинни, Дж. Х. и Ричи, Р. О. Затупление трещин, перекрытие трещин и кривая сопротивления механике разрушения в дентине: эффект гидратации. Биоматериалы 24 , 5209–5221 (2003).

    CAS Статья Google Scholar

  • 24

    Lin, C. & Douglas, W. Взаимосвязь структуры и свойств и трещиностойкость на стыке бычьего дентина и эмали. J. Dent. Res. 73 , 1072–1078 (1994).

    CAS Статья Google Scholar

  • 25

    Bechtle, S. et al. Остановка трещин в зубах на дентиноэмалевом соединении, вызванная несоответствием модулей упругости. Биоматериалы 31 , 4238–4247 (2010).

    CAS Статья Google Scholar

  • 26

    Smith, B. L. et al. Молекулярно-механическое происхождение прочности природных клеев, волокон и композитов. Nature 399 , 761–763 (1999).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 27

    Evans, A.G. et al. Модель надежного механического поведения перламутра. J. Mater. Res. 16 , 2475–2482 (2001).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 28

    Мейерс, М. А., Чен, П. Ю., Линь, А. Ю. М., Секи, Ю.Биологические материалы: структура и механические свойства. Прог. Матер. Sci. 53 , 1–206 (2008).

    CAS Статья Google Scholar

  • 29

    Бартелат Ф. и Рабей Р. Повышение прочности природных композитов. J. Mech. Phys. Твердые тела 59 , 829–840 (2011).

    ADS MathSciNet Статья Google Scholar

  • 30

    Бартелат, Ф.И Эспиноза, Х. Д. Экспериментальное исследование деформации и разрушения перламутра-перламутра. Exp. Мех. 47 , 311–324 (2007).

    Артикул Google Scholar

  • 31

    Налла, Р. К., Кинни, Дж. Х. и Ричи, Р. О. Критерии механического перелома для разрушения кортикальной кости человека. Nat. Матер. 2 , 164–168 (2003).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 32

    Айзенберг, Дж.и другие. Скелет Euplectella sp: структурная иерархия от наномасштаба до макроуровня. Наука 309 , 275–278 (2005).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 33

    Камат, С., Су, X., Балларини, Р. и Хойер, А. Х. Структурные основы трещиностойкости оболочки раковины Strombus gigas. Nature 405 , 1036–1040 (2000).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 34

    Буазиз, О., Бреше, Ю. и Эмбури, Дж. Д. Гетерогенные и структурированные материалы: возможная стратегия проектирования конструкционных материалов. Adv. Англ. Матер. 10 , 24–36 (2008).

    CAS Статья Google Scholar

  • 35

    Фратцл П., Бургерт И. и Гупта Х. С. О роли интерфейсных полимеров в механике природных полимерных композитов. Phys. Chem. Chem. Phys. 6 , 5575–5579 (2004).

    CAS Статья Google Scholar

  • 36

    Гаттасс Р. и Мазур Э. Фемтосекундная лазерная микрообработка прозрачных материалов. Nat. Фотоника 2 , 219–225 (2008).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 37

    Her, T.-H., Finlay, R.J., Wu, C., Deliwala, S. & Mazur, E. Микроструктурирование кремния с помощью фемтосекундных лазерных импульсов. Заявл. Phys. Lett. 73 , 1673–1675 (1998).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 38

    Glezer, E. et al. Трехмерное оптическое хранилище внутри прозрачных материалов. Опт. Lett. 21 , 2023–2025 (1996).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 39

    Giridhar, M. S. et al. Фемтосекундная импульсная лазерная микрообработка стеклянных подложек применительно к микрофлюидным устройствам. Заявл. Опт. 43 , 4584–4589 (2004).

    ADS Статья Google Scholar

  • 40

    Дэвис К. М., Миура К., Сугимото Н. и Хирао К. Создание стеклянных волноводов с помощью фемтосекундного лазера. Опт. Lett. 21 , 1729–1731 (1996).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 41

    Лю, X., Du, D. & Mourou, G.Лазерная абляция и микрообработка ультракороткими лазерными импульсами. IEEE J. Quantum Elect. 33 , 1706–1716 (1997).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 42

    Юодказис, С. и др. Лазерный микровзрыв в объеме кристалла сапфира: свидетельство многомегабарного давления. Phys. Rev. Lett. 96 , 166101 (2006).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 43

    Саллео, А., Сэндс, Т. и Генин, Ф. Обработка прозрачных материалов с использованием импульсного лазера наносекундной длительности инфракрасного и УФ-диапазона. Заявл. Phys. A 71 , 601–608 (2000).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 44

    He, M.-Y. И Хатчинсон, Дж. У. Прогиб трещин на границе раздела между разнородными эластичными материалами. Внутр. J. Solids Struct. 25 , 1053–1067 (1989).

    Артикул Google Scholar

  • 45

    Коттерелл, Б.& Rice, J. Слегка изогнутые или изогнутые трещины. Внутр. J. Fract. 16 , 155–169 (1980).

    Артикул Google Scholar

  • 46

    Ли Ю., Ортис К. и Бойс М. К. Жесткость и прочность швов в природе. Phys. Ред. E 84 , 062904 (2011).

    ADS Статья Google Scholar

  • 47

    Хайер Дастджерди, А., Пагано, М., Каартинен, М., Макки, М. и Бартелат, Ф. Связанное поведение мягких биологических «клеев»: эксперименты и моделирование. Acta. Биоматер. 8 , 3349–3359 (2012).

    Артикул Google Scholar

  • 48

    Андерсон Т. Механика разрушения: основы и приложения Тейлор и Фрэнсис (2005).

  • 49

    Lawn, B. Разрушение хрупких твердых тел Cambridge University Press (1993).

  • 50

    Smith, B. L. et al. Молекулярно-механическое происхождение прочности природных клеев, волокон и композитов. Nature 399 , 761–763 (1999).

    CAS ОБЪЯВЛЕНИЯ Статья Google Scholar

  • 51

    Баринов С.В. Определение работы разрушения хрупких материалов. J. Mater. Sci. Lett. 12 , 674–676 (1993).

    CAS Статья Google Scholar

  • 52

    Броз, М.